Chapter Text
The Silverscale Lounge Arena
Ep. 44: November 2025
Hosted by Baskerra “Lounge Bitch” Hellmane
All in favor of our Lounge’s Founders
(DISCLAIMER: All characters in sexual situations are 18 and over. Just to let you know)
Part 1: Spooky’s Pressurized Paradox
(Usually, these days, the contestants of an Arena overseen by two demonic entities, each one twisted in their own way, would only concern them getting thrown into just one new dangerous world. But there have been times in which they were thrust into a world that got visitors from another, often resulting in havoc. This was one of those times…only it was an outright FUSION of scenarios.
To understand what’s going on, there are two places to learn about. Two places filled to the brim with mystery, evil, tragedy, science gone wrong, and an inability to just STOP, regardless of how many horrors festered and took form.
The first of which was a creepy but seemingly harmless mansion on the top of a hill on a planet similar to Earth in a universe far away. Within this mansion was a single cartoonish ghost by the name of Spooky, who would challenge all visitors to come brave the 1000 rooms the place had.
That’s right. 1000. Turns out, the mansion was more than it seemed. It was a spot where seemingly endless horrors (or ‘Subjects’ as they were referred to) dwelled, each one worse than the last as the unfortunate visitors delved deeper underground in the further rooms.
Even worse was Spooky’s end-goal. Being the disembodied rage of a child’s tragically cut-short life, she desired to create a ghostly army made of those who perished in the mansion, the winners of her game becoming powerful spirits under her iron grip.
Thankfully, such a plot was ended when the mansion was destroyed after one thing led to another (mostly involving a dollhouse or something) and she reunited with her parents in the afterlife, her rage finally quelled as she got to rest in peace at last.
Thanks to the actions of Aresdemonia…such peace was fleeting.
The next place was located in the deepest darkest portion of the sea. A place where light could barely reach. Where untold terrors lived and thrived. Where a supremely corrupt corporation known as Urbanshade sought to use their seemingly limitless wealth for conducting unethical experiments and storing away strange entities of varying levels of hostility.
They even managed to enslave a Guardian Angel, the poor being’s blood being harvested in order to keep the employees from being damned to Hell for their actions. Not that it was enough to save their horrifically corrupt boss from being bound for that realm.
This was the Hadal Blacksite, an abandoned laboratory containing materials that the company wanted back at any cost, even willing to pardon the most heinous of criminals (or, at least, those wrongly framed and being pressured to do so) to investigate and get what they wanted. All the while having to avoid what terrors still lurked in that forbidden facility.
Unlike the previous spot, there was no sign that Urbanshade would be stopped…but it would seem the company’s finally hit a snag that no amount of money could fix. Mainly, the merging of that accursed Mansion of Jumpscares and the Hadal Blacksite.
Indeed, this Paradox has caused the entire Hadal Blacksite to start crumbling, hopefully putting an end to the lingering horror both places wrought, but it seems that the 48 contestants sent here are about to be caught in the middle of it all.
12 boxes, each one containing four characters, are currently stationed in the Jetsuit Evaluation Course. Normally, the convicts sent here would find themselves chased by a firewall created by the insane art program known as the P.AI.nter, the jumpsuit being the only thing getting them through the course. This time around, something else has entered this place. Something that has turned it even MORE deadly…
And it’s just one example of the mingling of terrifying forces here. Which of these contestants will make it through this gauntlet of horrors? Every room of doom? And, even if they reach the exit, there’s a good chance Urbanshade will be VERY keen on making sure none leave after what they’ve seen…
48 Characters, 12 ‘Teams’. 1 mad dash to the exit…)
Team #1: Predaking2000
It would not the first time the muscular megalodon anthro known as Velora had been sent to one of these Arenas, her nude form standing tall in the spacious Arena box, but it would certainly be a first in that she had to deal with a VERY rowdy teammate, if one could even call it that.
Slithering to a height that rivaled her own greatly, this massive freakish almost demonic hybrid of crocodile and cobra (complete with spikes lining the edges of the hood) let out a hissing roar, surging at the shark anthro with hungry intent. “Oh, sweet! They brought free lunch this time!”
The muscular one wrapped her large arms around the other’s head, only for those spikes to dig into her scales. She tanked it all, but the space was tight and the monstrous Cobragator kept squirming around, trying to latch its massive jaws around her tail or any other part of her body.
The other two were hopelessly oblivious to their surroundings, with the cat mobian of the duo being slightly less so. Big was no stranger to finding himself in random places, usually in search of Froggy, but he didn’t even have any memory of walking all the way here. Merely being teleported.
“Hello? Chris? What was the challenge again?” The ‘dumb princess’ of Total Drama herself, Lindsay, was looking around for any cameras, ignoring the clash of the titans happening in the very same box, even as Velora chomped down on the Cobragator’s tail and the behemoth managed to slam her into the wall with its head. “Have you also seen my lip gloss?”
She then realized she was in the presence of a parituclarly large cat-like being, causing her eyes to sparkle. “Oh…my…GOSH! So big and FLUFFY!” She instantly latched onto the big lug’s body, hugging him tightly and rubbing her face into his fur. “Mmmmn…never wanna let go!”
“Oh. Thank you. My girlfriend loves to do that whenever I get home. I hope she’s doing okay back there.” Big wondered. “Would you like to be my friend?”
“Totally!” She looked up at him, continuing to snuggle before she suddenly found herself face-to-face with the Cobragator, the enraged reptile roaring in her face. “Um…is that you, Tyler?”
Despite being fueled by primordial hunger, even the beast was momentarily confused before it was suddenly tugged by Velora’s arms, his head used as a makeshift mace against the door. “You two better buck up! We’re in for the long haul!” She warned, her toe-claws digging into the ground while the mutation tried to bite back.
Huddling into the bigger one’s arms, the two doofuses were soon realizing that this challenged look to be a dangerous one…especially due to the screaming they were hearing…
Team #2: TheStrange1
“The fuck?! How did I get here?!” The disgraced Hokuto Shinken warrior, Jagi, had been terrorizing the wasteland he called home before he was transported, sparring his victims of any further anguish at his sadistic hands. “Somebody better start talking!”
Despite being blinded by rage and his near-constant state of pain, he knew somebody was behind him, allowing him to whip out his shotgun and find it faced with yet another weapon similar to it, the barrels connecting as the two guys stared each-other down.
The disgraced former leader of the White Fang, Adam Taurus, was glaring hatefully at the human, both ready to fire at the slightest movement. “I don’t know why I’m here either, but if there’s one thing I do know…it’s that you human scum deserve worse than death.”
“Me?! Scum?! I’ll have you know that I’m top dog where I am!” Jagi declared, his tongue moving around his cheeks as the dishonorable fighter prepared some needles to spit at his new enemy. “You wanna talk about things worse than death? Try spending more than a minute with me!”
“You talk way too much.” Adam grunted, the two weapons blasting each-other, but it would be Jagi’s weapon that flew away, the martial artist letting out a yelp before he followed with a devastating series of strikes. Strikes that Adam was barely able to block.
Watching this whole mess with a bored expression was one of the two returners here, Juri Han. The sadistic taekwondo prodigy yawned, stretching as he got up from sitting. “Whoever wins here, you’d BETTER show me a good time! Make this random trip worth it for the both of us!”
“Oh, I can make it worth your while…”
The other returner, the Tarkatan-mutant known as Mileena, stepped forward with a sultry stare, her sais gripped in her hands. “You seem like SO much fun! I can see it in your eyes! Especially that glowing one! I could stare into it for hours!”
“Well, aren’t you a flirt?” Juri got into her usual fighting pose, grinning. “You think just because you’re the one with the sharp pointy things means I’ll be intimidated?”
Giggling, Mileena licked the sharp teeth behind her mask. “I hope not! I love a challenge! I want you to be as rough as possible!”
“Just the way I like it~” Juri licked her lips, causing the other fighter to chuckle along with her.
“We’re so in-sync! Let’s be friends…or let me gnaw on your bones! Whichever comes first!” Mileena clapped her hands, only for a shotgun shell to smack her on the head. “OW! YOU TWO KEEP IT DOWN!”
“Ignore them. Those idiots aren’t worth the time.” Juri waved her hand, especially as Jagi gripped around Adam’s ears, the two mindlessly running around before they smacked into the entrance, opening it up for the games to truly begin…
Team #3: Random-Person
This wouldn’t be the first time this Arena had to contend with the terrifyingly powerful blood-powered robot known as V1. If he didn’t win this one, maybe this wouldn’t be the last.
Standing creepily in one place, it was almost like the machine could smell the stench of death everywhere. Most would be repulsed by that, but he found it to be…enticing. It meant more fuel. More destruction. More ways to fulfill his prime directive.
Namely, destroy everything in sight. Ensure he would function forever.
“HERE I GO KILLIN’ AGAIN.” He stated in his usual distorted computerized voice.
His radar began to go crazy, detecting the presence of a truly powerful foe. One that didn’t have the blood he was used to, but blood was blood. Energy was energy. The means to destroy were the means to destroy.
Standing with a gaunt posture, a mixture of nobility and nothingness, was the being that was always meant to undo the terrible Radiance (remember that from two episodes ago?). A being that had no thoughts, but a mission that they would see to the end, no mouth there to cry suffering. A pure vessel…THE Pure Vessel.
This knight-like insectoid figure was now considerably larger than before, standing taller than the robotic being. At first, the Pure Vessel was more concerned with finding a way out, but V1 instantly got out a shotgun for each hand and began to open fire, bullets flying through the air.
The Pure Vessel was prepared for that, teleporting out of the way before summoning several spears, sending them flying at his robotic foe. More bullets would fly after the machine dodged and flew into the air, diving forth and clashing his arms against the blade of the emotionless but heroic figure.
Their audience consisted of two people who had met in their own crossover adventure. An ‘Indie Cross’, if you will. “So…feeling any better, Peasant-with-a-terminal-illness?” The strange goo-like being, the Beheaded, asked as he approached his pal. “Also, where are we?”
Wiping away some blood he had coughed onto his chin, the Drifter was quite glad to see that his friend was doing alright and no longer a golden statue. Alas, he had no explanation either, despite remembering having been sent here a while back.
“Maybe one of those portals showed up? Could have sent me back home, but nope! We had to get sent to someplace even more depressing! A box!” The Beheaded complained, several coins flying past him. He caught one, looking it with glee. “Hey! Money!”
BANG!
Bouncing off those coins, one of V1’s bullets struck his body, causing his still living amorphous head to plop down. “Do me a favor, pal. Scrap that rust-bucket!”
It did seem that the Drifter would come to blows with V1, as well…until the doors started to open, getting the attention of all four…
Team #4: 1nked
V1 wasn’t the only one from his universe to be sent here. Neither was the Pure Vessel the only one from his own universe. In terms of the former, the former Archangel known as Gabriel had found himself standing in this box, confused like the rest of his team.
“What? This isn’t Heaven…nor is it Hell…” He coughed after stating this, some of his blood escaping through the holes in his helmet. “I’m running out of time. I won’t have my final moments be stuck in-“
His defiant statement was interrupted when he heard the crying of a child, causing him to turn to the strange pink creature standing next to him. Poor Isaac had found himself in the Arena, leaving him as terrified as he usually was during his ordeal back in his universe.
The sight of an actual angel was only slightly more comforting than what he had to deal with, but he still cowered in the presence of the taller muscular figure. “A human? A living mortal soul?” Gabriel tilted his head, having not seen one of those in his world ever since the rampage of the machines.
Though more accustomed to battling and fighting for the corrupt Council (until his eyes were opened to his sins and theirs, of course), he remembered some of his gentler moments, greeting lost souls and sometimes even avenging them, despite what the Council desired. He knelt down, trying to seem less threatening. “Be not afraid, my child. Your guardian angel is here.”
Slightly more comforted, Isaac wandered closer, but he wasn’t the only one doing that. Known simply as The Knight, this insectoid vessel of nothingness, armed with nothing but his needle, stood passively, not moving an inch as he assessed what to do next.
“What cruel being would send mere children to a cage like this?” Gabriel wondered.
“A real jerk, that’s who! By the way, I like your wings! They’re so shiny!” An incredibly friendly soul and self-proclaimed ‘hint-master’, Terry Hintz, butted in. “But I’d still recommend learning from a pro if you wanna survive here!”
“There is no need. I’m fully capable on my own.” Gabriel assured. “Stick with me and I will see it that we all make it to the end.” He paused when he sensed something on the other side of the wall, causing him to start clenching around his blades. “HE’S HERE.”
“Uh, who? Demons? Satan?” Terry wondered, while Isaac cowered behind the Knight.
“Worse. The machine.” Gabriel both felt excitement at the prospect of fighting that mechanical terror to the finish, but the idea of these mortal souls getting caught in the crossfire didn’t sit well with him.
Still, as the door opened, he readied himself to face this challenge, and all other ones, with open arms…and all his might…
Team #5: Chianticat
The main gimmick of this team was ‘overpowered’. From whatever franchise they were from and perhaps in some different medium (original source material, video games, etc), they were considered terrors to fight and power fantasies to fight as (if, again, as three out of four were that case in video games).
Enough about that. A returner had come to the Arena. The ultimate android known as Perfect Cell. The insectoid being’s eyes opened as he stood with his arms crossed, realizing where he was. “I refuse to let this INSIPID scenario get the best of me. Maybe I should just annihilate those in here? Spare me the trouble.”
“ALERT: UNIDENTIFIED ARTIFICIAL INTELLIGENCE FOUND.” A hulking purple robot’s booming voice echoed through the box, his red eyes glowing as he looked down to the tall android.
Built by the paranoid and short-sighed Bolivar Trask, this ‘Sentinel’ may have been smaller than his building-sized other models, but that just meant he was faster, less bulky, and far more capable of utterly destroying those it considered ‘mutant’. Whatever filled those parameters was basically doomed.
Cell wasn’t impressed. At all. “And I thought my siblings were outdated models. I doubt you can be recycled into anything useful, given how utterly ridiculous you look.”
“INSULTS: INEFFECTIVE. INTENTIONS: HOSTILE?”
Beneath the two, a mass of purple ooze was slithering around, getting its bearings before starting to take the form of a pudgy villainous figure with a tentacle-like beard/hair. “Oooooooh, YES! THE OOZE IS BACK AGAIN!” Ivan Ooze exclaimed, spreading his arms around while lightning crackled around his fingers.
He looked around, finding himself between the intrigued android and the confused robot. “What is this? A sewing circle? Wait…A PRISON?! AGAIN?!” He fired a blast of purple lightning at the doors. “I don’t care if I’ve got cellmates! I’m not spending time I could be conquering the galaxy here!”
“MUTANT DETECTED? MORE DATA NEEDED.” The Sentinel wondered.
“I’ve got your data RIGHT HERE!” Out of anger, Ivan fired a blast of lightning at the machine, causing it to step back and try to restabilize itself.
“DANGER! DANGER! HOSTILES DETECTED! CONCLUSION: MUST DESTROY.” The machine declared, clenching its fists as it prepared to fight.
Cracking his neck in preparation for burning off his stress in battle, Ivan then noticed a much smaller caped figure with a sinister mask observing this. “You look plenty evil! Care to help a fellow villain out? Maybe become my dark servant? Benefits included?”
Meta-Knight, the mysterious protector of Dreamland, shook his head. “Apologies, but I serve nobody.” He spoke in his usual deep Zorro-like voice. “Especially not another self-proclaimed lord of all things dark.”
“You fools.” Cell chuckled. “This is amusing to watch, but I’ve got a game to win.” He charged up a ki-blast in his hand, aiming it at all three and gaining their attention. “Now, which one of you will I destroy first?”
His arm was suddenly sliced off in an instant, Meta-Knight having used his sword to do the job. Green fluid sprayed around, with the android looking appropriately shocked before he regenerated that arm instantly. “Your sadism will be the end of you. Attack with conviction, not cruelty.” The knight instructed.
“Well, aren’t YOU the wise little shit.” Cell glared, generating a battle aura.
“Don’t count me out! May the baddest of the bad win!” Ivan declared, even as the doors opened.
“ON MARK…GET SET…MOVE OUT!” The Sentinel shouted, choosing to instead rush forward to escape and return to its mission of mutant destruction rather than risk its own deactivation with the fight seemingly about to start.
Team #6: Kirby
Luigi Mario was always a little jumpy, but could you blame him now? Being suddenly teleported from looking around yet another ghostly mansion, Poltergust-5000 still gripped in his hands, to a strange new area was bound to make one more than a little startled.
“Keep your nerves, Luigi! It’s probably just King Boo trying to get under your skin!” He told himself, his New York accent echoing through the wide walls of the box and only serving to unnerve him further.
He let out a loud scream when he found himself staring at the wrong side of an arrow, the pointy tip pricking his nose slightly. “Don’t hurt me! I just got here and I did nothing wrong and I don’t know what’s happening and-“
The very withdrawn-sounding voice belonged to Bernadetta Von Varley, the painfully shy royal of the Black Eagles. Her limbs were shaking before she realized she was talking to somebody that seemed awfully reminiscent of somebody Byleth once spoke of during a strange tournament they described.
Luigi also calmed, holding his hands up. “Easy there! I’m not here to hurt you! Put the sharp thing down and we can talk this over.”
Lowering her bow, Bernadetta finally got a good glimpse of the man in green clothing. “All I remember is a flash of light and-“
“GAAAAAAAH! DEMON!”
“GAAAAAAAH! ¡¿POR QUÉ ESTAMOS GRITANDO?!”
That comically loud shriek belonged to Zenitsu Agatsuma, the blonde Demon Slayer corp member gripping his golden katana as he backed away from the large horned figure cowering from him.
In spite of his intimidating appearance (large horns, sharp teeth, big claws, shaggy purple fur), the imaginary friend known as Eduardo would never hurt a fly. In fact, he was the one the most frightened in this scenario, having been ripped from his friends and placed in somewhere where there was screaming and sharp objects.
He covered his head, shaking while the other three stared at him. “Stand back, everyone! I’ll slice him while he’s down!” Zenitsu declared.
“Wait!” Bernadetta shouted, sensing a kindred spirit in the strange demonic creature. A few more seconds of looking at him caused her to see more of herself in the poor lug, especially as he began to sadly mutter to himself in an effort to keep himself calm.
“Um…there, there?” Luigi wandered close to the imaginary friend, patting his arm.
Ceasing his cowering, Eduardo twiddled his hoof-like claws, getting a better look at his company. Even the one with the katana didn’t seem that scary, given how much he was shuddering too. “It’s…nice to meet you? How do we get out?”
“Wish I could tell you, but my brother always said where there’s a will, there’s a way.” Luigi assured before shaking his hand.
Zenitsu was already confused as to what was going on, but this just made things even moreso. This creature…he didn’t seem hostile. In fact, he looked almost benign compared to the demonic monstrosities he was familiar with. “So…we’re in the same boat.” He supposed before noticing the nerdy archer next to him.
‘OH NO! SHE’S CUUUUUTE!’ He thought, having to suppress the blood almost gushing from his nose. ‘Keep it together! Don’t forget you’re trapped with no way to-‘
Taking a deep breath, Eduardo looked at the door keeping he and the others from freedom. “Stand back, amigos. I’ve got an idea!” The fact that there was a seemingly easy way to escape had cleared his initial fright. “Get on back! I’ll protect you!”
“You’re quite kind. Th-thank you!” Bernadetta’s eyes sparkled when he felt the fur that she climbed atop of, finding herself wanting to cling and not let go. Luigi, meanwhile, knew where this was going, clinging harder while Zenitsu found himself having to get out of the way quick.
Ironically, the moment the imaginary friend charged forth, the doors immediately opened, causing him to comically trip onto the ground with his two riders. Zenitsu sweat-dropped at the sight of this. “I’m doomed.”
Team #7: Nighthawk87
The Equestrian unicorn known as Jet Hex had been away from Ponyville for some time, but news had traveled fast of the town’s fate. Not that it would be hard to hear of it, given the sheer devastation the planet was going through.
“They’re gone…they’re gone…” He repeated to himself, panting heavily after the ‘Spawn of Ragnarok’ had broken into his home at the moment of his teleportation. Indeed, those horrific creatures had begun to spread, bringing chaos and mayhem in their wake. His spells had been enough to keep them at bay, but they just kept coming.
“First time?” The feminine 20-something dragon, Spike, asked, his tail swaying around as he rested against the side of the Arena box.
“First time what?” Jet turned to the draconic one, recognizing him. “Wait, if you’re here-“
“Doesn’t look like any of my friends are here either. Just know that we’re about to get put through Tartarus if we don’t think fast.” Spike pointed out.
“DO NOT FEAR! THE GREAT AND POWERFUL TRIXIE IS HERE!” The boisterous stage magician unicorn had also made herself known, using a smoke bomb to dramatically make her appearance known.
That just led to the duo having a coughing fit. “ACK! It’s…cough…an honor…cough…to meet you in the flesh!” Jet tried to speak, having been a fan of the illusionist’s shows for some time.
“Ah! Even better! Trixie would have complained about the drab conditions she has suddenly found herself in…in fact, Trixie was this close to freaking out…but to know that she still has fans after all this time warms her talented heart!”
“YOU!” Spike shouted, coughing a bit more as he pointed at the magician. “Aren’t you that same unicorn that teamed up with Mokushiroku?!”
Hearing that caused the magician to sigh. “It’s…a long story. Let’s just say that me and that jerk had some creative differences. Just know that, whatever harm has come to our world, none of it was Trixie’s fault.”
“Wait a sec. Where HAVE you and your buddies been? We haven’t seen you in…ever. Probably for the best.” He almost calmed before narrowing his eyes. “Waaaaait a minute. That sounds suspicious.”
“A little touchy, aren’t we?” Jet wondered before noticing a figure huddled in the corner. “You good?”
Muttering to herself more loudly, the shut-in of a bookworm known as Moondancer was furiously scribbling into her notebook, accounting for everything that had happened before slamming her book shut. “You all want Twilight back, right?” She said quietly.
That caused all three to pause. “Excuse me?” Spike blinked.
“But isn’t she no longer with us?” Trixie wondered.
Standing up, the sweater-wearing nerd gripped her book tighter. “This place…I’ve heard of it in legends. This…’arena’…it could be the means of bringing her back.”
Remembering his own experiences in the Arena, Spike gasped. “Big Mac’s balls, you’re RIGHT! This place! I know how it works! If even one of us wins, we can bring her back and, maybe even better, restore all of Equestria!”
“I vote for the latter option! Equestria can thrive again with the help of the GREAT AND-“
“NO! It’s Twilight we need!” Moondancer insisted, only to backtrack. “Of course, if we can revert everything back to how it once was before Starfleet arrived, that could solve all problems…”
“Changing the past is kind of reckless. If this place really does all that at the end…you know what they say about wishes. You can never be TOO careful.” Jet pointed out.
Any further discussion was going to have to wait, as the doors were opening…and the screaming from outside was getting even more haunting.
Team #8: Buddhe
Dr. Phineas Waldolf Steel was more used to being the one causing mayhem in his pursuit of world domination. To be caught in the middle of it was…interesting, to say the least.
“This wasn’t in the schedule!” The bearded one said to himself, getting out a slip of paper from his shirt. “8:30 was when I give my robot doll army the power to shoot lasers from their eyes. If I don’t get back home, I’ll miss my favorite show on top of everything else!”
“Um…excuse me…I don’t mean to be a bother, but…where are we?”
Looming over the mad scientist was a large draconic humanoid. Curvaceous, pudgy, and sporting evergreen scales, she looked like she was nervous 24/7, twiddling her claws while struggling to maintain her composure. “I-I-I’m sorry! I didn’t mean to assume you knew the answers-“
“Actually, my gargantuan reptilian friend, you are right to think I have the answers! I have the power of my brilliant mind to help me get through what is obviously a sleep deprivation-induced fever dream of mine!” Steel put his hands on his hips. “Finally! I think I’ve cracked the code to being FULLY in charge of my dreamworld!”
“…what?” Maple blinked, only to feel something brush against her large tail.
Turning to apologize to whoever she accidentally nudge, she saw that it was a demure-looking shark anthro in a Victorian-era maid uniform. Despite being intimidated by the draconic one’s height, she still tried to sign for ‘hello’, as well as asking where the exit was.
She was also noticed by Dr. Steel, his eyebrows raising in surprise. “A land shark? This dream realm is getting more interesting!” He examined her outfit more closely, giving a soft smile. “Takes me back to the time I made ‘Blade Maid Doll 9000’. Could shred through titanium and dust particles in less than a second.”
“Verdammt nochmal. What was in that vodka?”
A very very very VERY unwelcome face was also among this group, holding a rifle and still dressed as he was during his atrocities in the Congo during the 60s. Plucked from a fictional version of history was one of its monsters. A depraved brute who gained a reputation as a horrible butcher who reveled in his own corruption.
Siegfried Muller.
Getting his bearings, the man gave an ugly grin when he saw the strange sight of a walking shark and a reptilian-looking woman. “This is going to look so good on the jeep.” He momentarily forgot his shock at being transported from his timeline, ready to indulge in his cruelty once more.
Dr. Steel was suddenly in front of him, brandishing a gasoline squirt blaster (essentially, a makeshift flamethrower). “Hold on! I know my history! This dream’s turning into a nightmare, but not on my watch!”
“Can we talk about this?! Nothing good comes from violence!” Maple insisted, while the Lonely Shark hid behind her large tail, not looking forward to the fight about to happen.
Before anybody could come to blows, the doors began to open…
Team #9: Snivygreen22
“SURPRISE!”
“BOO!”
“SCREE!”
“What’s up?”
All four figures had tried to spook each-other on instinct for their own reasons, but what they got instead was a whole lot of confusion.
The first of which was a Karakasa named Kogasa Tatara, who came in the form of a woman with heterochromia, a blue dress, and a one-eyed umbrella with a long tongue. All she wanted to do was surprise people in her cemetery, but she didn’t expect to find herself confronted by three somehow scarier beings!
One of which was a terrifying sapient pumpkin-headed scarecrow that carried a sharp hoe. His origins wrapped in mystery, this otherworldly being was now looking less than pleased to see that he wasn’t in his beloved cornfield and his compatriots were also nowhere to be seen. “What the?!” He exclaimed, looking around in shock. “Where am I?!”
The animal of the group that had screeched in territorial rage was a Nightshade Paolomu, the bat-like being almost expelling sleeping gas in order to knock out the perceived threats it found himself sharing space with. Baring its fangs, it backed away, ready to unleash the gasses from its maw.
The final one was a surprising addition: Spooky herself! However, the usually chill yet maniacal ghost was acting differently than usual. Showing no trace of the development she gained through that dollhouse adventure, she started to glitch out, still bearing that smile of hers while brandishing a holographic and still effective knife.
“Eep! I thought surprising people was fun! But to be surprised myself…this is new!” Kogasa admitted, holding her umbrella close while Zardy stalked around her, his eyebrow raised at the strange surroundings.
“You’re no human…and this isn’t home! Somebody let me out of here before I REALLY get upset!” The scarecrow demanded, only to get nearly struck by the Nightshade Paolumu’s tail. “Watch it, you overgrown bat!”
“SCREE!”
“Can you solve my house-house-house-mansion-help-help-of 1000 rooms-rooms?” Spooky asked, her body glitching more and freaking the others out.
Noticing how the door was opening, Kogasa bounded on one of her legs towards it. “That’s it! I’m getting out of here! This is too much, even for me!”
“Wait for me! Us spooks and spirits shouldn’t have to put up with this!” Zardy exclaimed. “Perhaps we can help each-other? I sense great power from you.” He leaned in, grinning.
“Um…okay! It sure feels nice to feel wanted!” She blissfully said, forgetting her troubles almost instantly.
The Nightshade Paolumu, meanwhile, was now observing the glitching ghost, not sure what it was looking at. Meanwhile, Spooky kept t-posing into the wall, unable to phase through and increasing the sense that something really was up…as if it wasn’t obvious enough already…
Team #10: GenericoThrown
The ever-friendly MRVN unit, Pathfinder, was still his usually cheery self, even after getting transported to a place that he didn’t recognize. “Hello, giant tank robot! Will you be my friend?”
“ZOW! BAM! Would I ever?!” Returning to the Arena was the boisterous and easily excitable Autobot tank, Warpath. He loomed over the smaller robot, kneeling down as he shook his hand with two digits, shaking around the metallic Apex Legend. “I’ve always wanted to take another crack at this place! You ready to rock, whats-your-name?!”
“I don’t know who this ‘Whats-your-name’ is and I don’t know how to ‘rock’, but I know how to fight and ensure my friends don’t get hurt! So, I’m all for this!” The robot gave a thumbs-up, his chest showing a smiley emoticon.
“Heh! I like you already!”
“Well, hello, darling. Fancy seeing you again.” Another returner, the Assaultron known as Kleo, had also returned, trailing one of her claws against Warpath’s thigh. “I hope you’re ready for more gratuitous mayhem and destruction. It’s the perfect idea of a date, no?”
“Kleo?! WHAM! BOOM! This is awesome! You’re here too!” The Autobot stated, gesturing towards the other robot fighter. “Met the new guy yet? Oh! That reminds me! There’s always a fourth guy! Come on out! Join the party!”
Yet another returner, the Geth collective known as Legion, stepped forth, recognizing the mission parameters that were familiar from last time. “Greetings. Given our observations, we are willing to believe that you three are non-hostile robotic lifeforms. Ones that would hopefully assist in our desire to return home to our companions.”
After that lengthy explanation, Warpath just shrugged. “Sure. I just wanna use this a lot.” He tapped his chest-mounted barrel.
“I want to explore and have fun!” Pathfinder exclaimed.
“I want murder.” Kleo’s sole red optic glowed more. “And maybe some ‘interfacing’ with my stud here.”
“Aw, TANK you! Heh!” Warpath chuckled.
In spite of how eccentric their team was, Legion would not let that negatively influence them as they readied their sniper blaster. If this was going to happen like last time, he would need to be prepared for anything. Hopefully not an army of endless giant robotic insects, but still.
Team #11: Malice
While only one or two of these combatants had to deal with this Arena, all four were connected by the fact that they had been chosen at some point or another by the enigmatic ‘Entity’ to participate in a twisted game of hide-and-seek in order to provide despair/hope-based nutrients for the mysterious being.
They included the Shape himself. The masked killer better known as Micheal Myers, back in his prime and staring vacantly at the surroundings around him. Was he confused? Treating this like an average Tuesday? Thinking of nothing else except who his next victim would be? Nobody could figure it out, given the mask.
All that could be assured was that absolute evil dwelled behind those eyes. Evil, plain and simple.
Far less evil and much more reluctant to take part in any murderous havoc was Susie Lavole, having been ripped from the collective killer known as ‘the Legion’. Her tale was one of tragedy, having basically been part of the wrong crowd before finding herself roped into murderous criminal activities and, now, here she was, armed with only her custom broken ruler weapon.
No longer feeling the influence of her fellow Legion members, Susie began to panic, gripping her weapon before realizing Michael was staring at her, those cold emotionless pits around the mask that were supposed to be eyes making her back into the other killer of the bunch. “So…you too, hm?”
A hideous amalgamation of rotting animatronic bunny suit and rotting serial killer corpse within, William Afton/Springtrap had returned to the Arena, a fire axe in his hands. “Given your get-up…I’d say you’re here to join in the fun. Shame I consider myself a solo act.”
“What…the fuck?!” Susie backed away, the sight of the two terrors quite a lot for her to bear, though that was nothing compared to the spectral being of rage that was making herself known via a horrifying scream of fury.
Wearing nothing but a sarashi outfit and armed with a broken katana, as well as looking like one of her arms and legs were held together by spectral energies only, this was Rin Yamaoka, better known as ‘the Spirit’. Still seeking brutal justice for her murder, she could only see her father when she saw the other three combatants.
“DIIIIIIIE!” She roared, lunging forth, only to freeze mide-attack. The other three looked confused when that happened, only for it to vanish and, instantly, she was behind Micheal, slashing him across the back.
Already going into attack mode, the knife-wielding killer lunged with his knife, to which she stumbled out of the way. Springtrap was content to watch this fight, watching as the door started to open.
“The real party’s out there. You two play nice. I’ve got a game to play.” He stated, eagerly awaiting not only total victory, but also the chance to spread some more chaos.
Susie, meanwhile, wasn’t sure whether to blush hard at the sight of the rather beautiful (if still gruesome) spirit…or flee before Rin turned her attention towards her. She already knew her life was going to take a permanent turn towards the weird and frightening after that fog took her and her friends into the Entity’s realm.
Now? They were gone and she was the only one left here. Adjusting her mask, she ran towards the exit, hoping the undead-looking bunny killer wouldn’t notice or care when she crawled under the opening doors to what was going on outside…
Team #12: The Wandering Pikachu
What a strange and melancholy day to be the now college Kraken known as Ruby Gillman. She and her best friends were about to be accepted to the same place and NOW the Arena had transported her to an entirely new location. “Huh?! Where am I?!”
“Couldn’t tell you, but could you step aside? The role of main character is FINALLY mine! MINE!” A pudgy cartoonish red/purple octopus exclaimed, squirming next to her. “Seriosuly, scram. You’re in my light.”
“Don’t be so rude. We’re all in the same shocking set of circumstances together.” A much more kindly and cheerful voice spoke, the taller figure being an orange octopus anthro in a slightly revealing blacksmith outfit and a warm smile, as well as a large hat. “Looks like whoever sent us here wanted seafood!”
“Uh…not sure why you would joke about that, but…hmm…we’re obviously here because of magic. I can’t think of any other explanation.” Ruby tried to rationalize things to calm herself down. “I think I heard something about needing to escape or-“
“Or maybe you could stay a moment and watch the revival of my artistic career!” A robotic octopus stepped forth, the former Maverick revealing himself to be Launch Octopus. His many tube-like tentacles writhed around, the mechanical one eager to show just what his definition of ‘art’ was.
One that involved lots of explosions and overall destruction.
“That’s a funny looking suit of armor you have! Maybe I could make some improvements…for a small fee?” Always one to look on the bright side of things, even this strange scenario, Hama was already getting out her hammers and chisels with her tentacles.
“WHAT?! Improve upon perfection? Surely, you jest.” The Reploid spoke in his usual haughty tone before realizing something. “Wait…you three are organic…and I can’t put my tentacle on it…but your looks are quite splendid! Not as much as me, but close!”
“Thanks? I guess?” Ruby awkwardly stated.
“Oh, I get it! This is an RPG and you all are my quirky companions! Better not steal the spotlight from me!” Squid Baron pointed a tentacle in an accusatory way at the Ruby first. “YOU might steal it due to being charmingly awkward!” Then to Hama. “YOU may steal it from me because you have a huge rack!” Finally, to Launch Octopus. “AND YOU BECAUSE YOU DARE TO LOOK COOLER THAN ME!”
“It’s not my fault I’m better than you.” The robot chuckled.
“Can we please focus? I think the door’s opening!” The Kraken pointed out before turning to Hama. “Ready to transform if worst comes to worst?”
“Transform?”
“You know….because you’re a Kraken like me?”
That just caused the blacksmith to give a blushing smile. “That’s such a sweet compliment, but I’m just a humble octopus! Try not to stress out so much. Learn to appreciate the scenery!”
Little did she know just how terrifying or morose or both the ‘scenery’ was going to be...
The stage was set. The doors were opening and everybody would find themselves in the N.A.V.I Jetsuit Evaluation Course. Normally, the convicts who found themselves here would find themselves running through an obstacle course of many jumps, glass walls, conveyer belts, and so forth, the jumpsuit helping those trapped navigate.
The catch? They’d be chased by a massive wall of flames, thanks to mischief on the part of the P.AI.nter. But he wouldn’t be the cause of the mayhem that was about to ensue. Granted, the Firewall was activating, but the room’s lights started to flicker, the background now looking like a hellish red hallway.
In front of all the combatants, a single cartoonish white cat would be sitting in front of them, a melancholy expression on its face. “Face your demons and come out stronger…or succumb and never return.” It spoke with an air of wanting to help, but being unable to do anything.
A distorted laugh/cry rang out, the cat vanishing as the halls glowed even more red, the wall behind the District Boxes no longer being one of flames, but now looking like a hideous red portrait of distorted skeletal corpses. The sight would hurt the eyes of all who looked upon it, but even worse was exactly this thing WAS.
A collective hallucination representing the inner turmoil of the combatants that was there in place of the very real Firewall? A living mental projection that sought to bring agony to all who couldn’t run from it?
“Attention, visitors!” The N.A.V.I voice finally rang out, albeit it sounded like screaming was in the background. “Thank you for making it to the evaluation course! For those who need it, grab a jumpsuit at the start of the course. Then, G E T O U T W H I L E Y O U S T I L L C A N ! ! ! ! !”
3...
...2...
...1...
ESCAPE THIS HORRIBLE PARADOX!
PART 2: The Firewall of Incomprehensible Madness
(R U N-Pressure)
https://www.youtube.com/watch?v=auKTQfrfJi0
Specimen 7 would waste no time, pushing through the halls as water began to leak through the ceiling, dripping down as the walls continued to glow a horrific shade of red, the screaming from the fiery entity coming close filling the entire course.
“That doesn’t look good.” Pathfinder stated, everybody looking behind themselves.
“That’s not good at all!” Maple cried out, crying in terror at the hideous sight rapidly heading for them.
“What in the Father’s name?!” Gabriel extended his wings, picking up the horror-stricken Isaac while the others got behind his wingspan.
“HAUL ASS!” Velora grabbed Lindsay off her feet, everybody dropping everything to not look back and FLEE!
The chase music was blaring all over the place, Spooky’s distorted laugh/crying also joining the horrific noise. The course also seemed to be bending in on itself, causing it to randomly bend angles and change where the doors to the next room would be shown, almost like this Paradox was forcing this location to conform to whatever rules the Mansion had with limited success.
Pathfinder put his grappling hook to great use, sailing over the course entirely, but always making sure the others were following. Warpath may have been freaked out initially, as he wasn’t built for speed, but he found a way around it.
“KAPOW! BOOM! SHOOM!” He used his own barrel to blast at the platforms, essentially driving and propelling himself backwards through the air. “HOLD ON TIGHT, GUYS!”
Kleo and Legion held onto his body, keeping a watch as so many of the other combatants followed around. The Geth would also fire at several platforms ahead, causing them to fall and provide an extra means of the large Autobot landing somewhere.
Several purple laser blasts smashed through some of the runnable walls, almost knocking Adam Taurus off when he ran across them. The Sentinel was on the warpath, trying to blast its foes while sharing none of the fear of being chased by the horrific construct behind them. “DESTROY. SLAUGHTER. ANNIHILATE.”
“Annihilate THIS! KAPOW!” Aiming his shot just right, Warpath fired at one of the robot’s legs, disabling one of his rockets and causing him to stumble long enough to collide into the rapidly approaching wall.
Letting out a horrible mechanical screech, it was reduced to lifeless metal, burning up and exploding while Specimen 7 continued on its path, Gabriel being among those flying to escape the madness.
However, as he flew through the air, holding Isaac and the Knight close, Terry was holding onto his leg, trying not to let go. “I’m slipping!” He cried out.
“Do not lose heart! Hold on for just a little while longer and we’ll…” Letting out a gasp, the angelic figure noticed a familiar face running across the walls and effortlessly platforming through the mayhem. “YOU! MACHINE! I KNEW OUR PATHS WOULD CROSS ONCE MORE!”
Flying down to intercept V1, his two words were parried successfully, the machine flinging several coins that he shot at, resulting in the ricochet striking the angel and nearly making him lag enough for the wall to consume him.
A fate that unfortunately happened to Terry. “GAAAAAAAAUAUAUAUAAUA!” Becoming one with the wall as he burned alive, his screams echoed while Gabriel increased his speed, shamefully looking away as Isaac wept and the Knight got atop his back, taking a more active role in making sure they’d get out alive.
‘How could I let my wrath overtake me in such a pivotal moment?! Damn this machine…damn what it has done to me.’ He thought, only to shatter through a glass wall. “FUCK! MY EYES!” He gasped again when he realized what he said in front of Isaac. “I mean ‘FUDGE’! That’s what I said!’
“Hehehahahahaha!” Ivan Ooze had transformed into a shimmering flying pile of goop with his face, slithering under most of the fighters. “See ya’, drips!”
“Who are you calling ‘drips’?!” Squid Baron shouted, running as fast as his tentacles could carry him while Ruby, transformed into her Kraken form, pushed through most of the course, squeezing through even the smallest holes (comparable to her kaiju-sized form, that is) and keeping Hama and Launch Octopus close.
“Don’t look back, don’t look back, don’t look back…” She kept repeating to herself, almost feeling one of her feet-like tentacles get near the wall and feel the sheer amount of suffering that being even in the vicinity was bringing her mind.
“This is humiliating! I want to fight! How else can I do my art?!” Launch complained, even as his tentacles wrapped around the fingers holding he and Hama close to their giant companion.
The Squid Baron would join them when he got a ki-blast to the side, sending him into the embrace of the rushing Kraken. The culprit was Perfect Cell, the flying being grinning while outpacing most of the other combatants. “Amateurs.” He yawned, but he made the mistake of looking back during then.
Even for a vile being like him, the suffering that was shown within that seemingly living wall caused his inner circuitry to crackle, his wings spasming and screwing up his flight pattern. “WHAT THE HELL?!” He cried out, spiraling through the air while smashing through several platforms and runnable walls.
As he stumbled mid-air towards the exit, Moondancer was among the many outfitted with the Jetsuit, allowing her to keep pace with the others while she and the other members of her team fled. “According to my calculations-“
“LESS CALCULATING AND MORE RUNNING! TRIXIE IS TERRIFIED!” The magician interrupted the unicorn, also using a jumpsuit that she found enhanced by Jet Hex’s magic.
“At least the first part of my name is making even more sense than normal!” He chuckled, his horn working the dark magic into overdrive as the suits unleashed black flames from their boosters, sending them hurtling through the maze and bypassing many of the obstacles.
Spike was also keeping pace, but only because he was flapping his wings as much as he could. “Wait…for me, guys!” He shouted, trying not to look back and REALLY trying to tune out the possible screaming voice of Twilight Sparkle.
Moondancer almost faltered because of that, but another burst of black magic from Jet Hex ensured she would be propelled before she could hesitate long enough for the wall to claim another victim.
Dr. Steel had a way to bypass this terrible situation. An appropriately zany one, at that! Basically, a propeller hat that spun at such a speed that the winds could be comparable to a hurricane. “Hold on ti-OOF!” His hat nearly failed when Maple grabbed onto his leg, the Lonely Shark huddled into her chest during so.
“P-please hurry!” The draconic one begged, scared tears streaming down her face as she heard the screaming get louder. “I don’t want to die! I never got to confess to Herald how I feel!”
“We’re not going to die! NOT WHEN I SHIFT INTO MAXIMUM OVERDRIVE!” He tapped on his hat, causing the propeller to spin even faster, blowing all three combatants forward while they spun around helplessly. They’d be alive at the end, but VERY nauseous as a result.
Oh, and where was Muller during this whole chase? Simple. Dr. Steel tripped him before this could begin and he was the first one consumed by Specimen 7. Simple as that. Serves him right.
Anyway, moving on.
The Drifter and the Beheaded were no strangers to platforming, so they didn’t need the suit while they dashed and sped their way through the seemingly endless halls. “I think we’re losing it!” The latter stated, despite that NOT being the case. It was like the strange Specimen was getting faster and louder…
Something that Velora was keenly aware of when she rushed across the platforms, her training with Talon really paying off. “C’mon…work through the pain! Don’t look ba-ACK! Where did the lights go?!”
Lindsay’s breasts had found themselves covering her vision, the woman holding on tightly to the now blinded Megalodon. She was too busy screaming to hear the shark anthro’s objections, but, thankfully, the electroreceptors the muscular one had allowed her to at least follow the ones running ahead of her, allowing her to still make it through the course.
Big was using his fishing pole to grapple from one place to the other, his surprising speed also helping him during this. “Wait for me, guys!” He declared, meeting Eduardo and company while he swung around. “Hello!”
“HOLA! NOT TALK NOW! GOT TO RUN!” Eduardo was screaming his head off, the others huddling around him doing much of the same.
Unfortunately, their luck would not be so good, as the Nightshade Paolumu flew over them, expelling sleeping gas as it kept refilling the air sacs that contained it, propelling itself faster in an attempt to flee the strange thing chasing it down.
“Need…siesta…” Eduardo started to feel so drowsy that he wound up slowing down on a conveyer belt that was moving backwards. Lazily, he tried to save his friends by throwing them forth…and only succeeded with Luigi.
The drowsy plumber would wake up VERY quickly when he found himself landing on the Spirit, the entity having been driven furiously wild by the pain happening within her already tortured mind. “RAAAAAAAAGH!” She screeched, randomly slashing her katana while Luigi found herself holding onto her back.
He was practically ragdolled through the air during this chase (despite being taller and larger than her), phasing along with her and making him scream louder. His screaming only ceased when he looked back, looking horrified at the fates of his companions.
Eduardo’s howls of agony. Bernadetta’s screams of anguish. Zenitsu’s cry for his friends. All becoming one with the Specimen while their bodies burned up in a horrific display of red light and the fusing of their skeletons with the mass.
Luigi couldn’t get those voices out of his head. He felt tears form in his eyes as he tried to work through his fear. Letting go of the spirit he was riding atop, he narrowly avoided a slash of her katana as he increased his pace, his good jumping abilities coming in clutch for the final stretch of the chase.
The Pure Vessel dashed through the halls, slashing through any obstacles as he occasionally clashed with Meta-Knight. Their blades sent sparks around the hallway, the smaller winged knight flying circles around the insectoid warrior, but the other countered with teleports and random spears coming out of nowhere.
Their clash was nearly interrupted when the Cobragator flew through the air, rode atop by Jagi as he punched down on the poor creature’s head. “HURRY THE FUCK UP, YOU STUPID SHIT!” He tried to sound intimidating, but he was panicking deep down, having made the mistake of looking behind and seeing the horrific thing that was intent on chasing the combatants down.
Two of those acing the obstacle course without the jumpsuit were Juri and Mileena, the two dropping their usual sadism to focus on getting away from whatever this THING was. Not that the mental anguish this thing wrought was making it easier.
It was driving Mileena into an animalistic frenzy, her sais helping her to rush on all fours across the platforms and through the doors, while Juri was screaming in both fury and pain, hating having to go through the traumas she went through before in her own mind while also trying to win this.
Spooky was still glitching as she phased through pretty much everything, while Zardy used the jumpsuit and his hoe to swing and zoom through the landscape, Kogasa flying through the air current made by Dr. Steel with her umbrella. “This isn’t surprising! This is TERRIFYING!”
“It is what it is! KEEP GOING!” Zardy commanded, wishing he had rose atop the Nightshade Paolumu to make this easier.
Finally, Springtrap, Micheal, and Susie had also put on the jumpsuits, with the Shape brute-forcing his way through the platforms in an attempt to stab into anybody that tried to escape him. If anything, the entity behind him was amplifying his murderous impulses.
The near-undead rabbit-like figure was more focused on getting out of there, grasping his head when he almost heard the angered screams of his victims behind him. “Nonononono….NOT AGAIN! I’M NOT LOSING TO YOU AGAIN!” He roared, dashing enough to make his suit start to malfunction.
With the terrified Susie being the last to enter through the exit, the warped nature of this Paradox would ensure that all remaining had escaped the terror of Specimen 7 would find themselves in random corners of this Paradox.
And there was also the sense that someone was watching them. Someone viewing this event with hate…and a tinge of fear. Someone or something that would do anything to see that certain friends of his would continue to prosper from this grim place, damn the consequences...
Notes:
Current Dead:
-Sentinel (Team 5)
-Terry Hintz (Team 4)
-Bernadetta Von Varley, Eduardo, Zenitsu Agatsuma (Team 6)
-Siegfried Muller (Team 8)
Chapter Text
PART 3: The First Few Rooms
Instantly, anybody who made it through the main door would find themselves in a random assortment of room. Thanks to the merging with the Jumpscare Mansion, the remaining combatants would find themselves in various places in the facility, all without rhyme or reason.
Just the way Spooky intended for it before she gave up on her vengeance.
One of those rooms was a seemingly idyllic forest, but the walls of the derelict Blacksite were surrounding it, mist pooling around the spot while several of the combatants moved through the sudden woods.
“Am I back in the forests again?” Big wondered, scratching his head before calling out. “Froggy! You there?”
He was suddenly pulled behind a tree by Velora, the Megalodon anthro covering his mouth tightly while she struggled to stay hidden. Not an easy task when you were nearly ten feet tall. “Keep…quiet.” She growled. “However we’re here, it ain’t natural. There’s bound to be SOMETHING that wants us dead.”
“Like a bear? Or a chainsaw maniac? Or a bear maniac with a chainsaw?” Linday wondered. “Or maybe it’s filled with happy woodland critters, like in those movies me and my dad would watch together!”
“Don’t be so optimistic. There’s no way we’re that lucky.” Velora pointed out, even as several deer began to emerge. “Then again, I could use a snack!” She licked her lips, eying one of them.
“Don’t you dare! Look at how cuddly and cute it is.” Lindsay held out her hand to one of the deer, only for it to suddenly snarl, the eyes becoming red. “Did somebody wake up on the wrong side of the leaves?”
“Eating it now!” Velora lunged, chomping down on its back, only for its razor-toothed maw to let out a hideous roar that echoed across the woods, the rest of the deer suddenly swarming them. “Oh, shit! Screw the snack! I’m out!” She used her tail to smack away the others, while Big held Linday protectively to his chest.
Something was smashing through the trees, catching the group’s attention and even diverting the deer’s attention away from the group. A massive tank (Warpath) was smashing his way through the trees, causing what appeared to be a bunch of humanoid plant creatures to chase him.
“BOOM! BAM! Try and catch us, guys!” The Autobot joyfully exclaimed, his barrel making short work of the incredibly strong DiVine that weren’t taking kindly to the intruder in their woods. A few stopped to battle the deer, the vicious creatures ripping into their vines while their strength pulversized many more.
Kleo spotted the other group, firing her lasers and forcing Velora to tank a few hits. “GAH! FUCK! Watch it with the lasers!” Grabbing a nearby tree, the Megalodon anthro uprooted it so she could throw it at the Autobot tank, nearly knocking him to the side.
“OUCH! WARPATH, TRANSFORM! “ Turning into his robot mode, the bulky Autobot held Kleo close, ready to fire his barrel at the duo, but he then saw that it was scuffed by that tree. “ACK! POW! Gimme a sec, guys! Need to clean my baby!”
“Aren’t we going to inflict more gratuitous violence?” Kleo wondered as the two fled.
“Not now! We also gotta find the others! Who knows where they went?!” Still trying to wipe away the grime from his barrel, the massive bot made the ground shake as he moved, the DiVine still chasing after them.
Big noticed how several were coming for them, causing him to start running. “Better hurry up! I think it’s time to go.”
“You think?!” Velora huffed, carrying Linday and shoving her between her bare breasts. “Just hold on! Grip if you wanna. I don’t mind.” She gave a flirty smile due to that.
“Oh, wow!” Linday blushed, feeling around the firm but soft scaly breasts keeping her in place. “My boobs are definitely softer, but I never knew they could get this big!” She began to go on a tangent as the trio ran, their other team member having its own troubles.
In addition to the ravenous deer and the DiVine, the Cobragator was finding itself on the retreat when the Pure Vessel came after it, sending spears and flashes of destructive light after the serpentine beast. Moving from tree to tree, it was only the hybrid’s great speed that prevented it from being reduced to giblets.
As for where the rest of Warpath’s group was, aphrodisiac had been floating in the mist. A leftover from Aresdemonia’s possible involvement in this paradox. One that was strong enough to affect the very machines that were finding themselves a part of this bizarre game.
But not without it looking awkward, as all three except Legion lacked genitalia. Thus, V1 and Pathfinder found themselves clanking each-other’s asses together, while Legion stood around awkwardly, stroking his synthetic cock as the wires sparked around it. “Internal temperatures rising. Unable to contain phenomena known as ‘nut’ any longer.”
“CAN YOU DIG IT?” V1 asked, doing perfect splits while sparks flew from how his steel booty struck Pathfinder’s.
“I am not in the process of digging, but I am very excited for some reason to keep doing this! I feel as if we are forgetting something.” The MRVN unit pointed out.
“YOUR SUBMISSION IS INEVITABLE.”
If it wasn’t the fact that they were separated from their teams that they forgot about, it was also that they were in uncharted territory. One inhabited by a being that the DiVine had been hopeless in trying to repel. The one that commanded the monstrous deer seen earlier.
Specimen 8. The Deer Lord.
The cloaked monstrous figure was gliding across the forest ground, slipping from tree to tree as he spoke in that distorted voice all the more. The aphrodisiac was quickly fading in the machines, all recognizing the very real threat ahead of them.
“SWIGGITY SWOOTY!” V1 began to open fire, but his bullets were being absorbed into the cloak of the being, confusing the winged being as he tried to strafe around him.
“Friends, maybe it’s best if we ran.” Pathfinder pointed out. “Wait! I think he wants to give hugs! That’s why he is opening his cloak, approaching me, spreading out his arms-“
“We need to leave.” Legion pulled him away, leaving V1 to continuously annoy the strange entity as he tried to absorb the annoying bloodthirsty robot. “It is pointless to continue battle with an entity that cannot be harmed through conventional means.”
And so, they would leave this Oxygen Forest to its devices, the DiVine occasionally showing up to attack the mechanical lifeforms. They were pushed back by the firepower, though they would find themselves attacked by another being.
The Nightshade Paolumu was still in panic mode, screeching as it divebombed the duo and only grew angrier thanks to the bullets and laser-blasts. “Fight all you want, but I’m not letting you creations of man stand in my way!” Zardy was riding atop the beast, using corn stalks as ropes for his mount and his hoe as his weapon.
“Technically, I am a creation of-“ Legion was interrupted again when that hoe nearly took off his head, the sniper shot he let out missing due to the sudden strike. At least the sleeping gas wouldn’t work on him or his companion.
“How could something so cute be so frightening?” Pathfinder wondered about the bat-like monster, an umbrella tapping on his shoulder.
“Surprise!” Kogasa waved, her umbrella slathering its tongue across his screen. “Wait. Can a machine be surprised? Did I push too far?”
“No! I am very surprised! As long as you feel good about surprising me, all is fine!” The robot gave a thumbs-up. “I like your umbrella, too. It has a funny face!”
“So do you!” She giggled, but she then pointed to a door. “I don’t really want any of you to be hurt, so you better keep running! It’s not safe here! These woods are creepy, even by my standards.”
“WHY DO YOU FLEE? YOUR DESTINY AWAITS.” The Deer Lord was back, having given up on trying to absorb the still-marauding robot firing at him from behind. The bullets passed through his form.
“NOPE. NOPE. NOPE.” Pathfinder was the one to grab Legion this time, using his grappling hook to get them to the exit faster, with Kogasa also letting out a shriek as she bounded away, flinging some water droplet-like energy blasts to try and keep the fiend at bay.
Zardy observed this from above, narrowing his eyes. “A shame. She’s too soft to be working with me. Fine. Let her do her own thing, as long as she doesn’t get in my way. What about you, Spooky?”
Looking to the ghost that had been floating next to him, all she did was laugh and laugh and laugh some more before fizzling away, glitching while letting out a horrible cry of pain and despair. It was enough to leave even him unnerved, while his mount flew towards the exit, desperate to escape. “HEY! Give me a warning next time!”
A mere hologram, in the end, she was. The only question was…what was up with the real one during this time?
Okay, that wasn’t the only question. There was also what had become of the other combatants.
Several of the rooms were more just wrecked Hadal Blackside hallways, some warped to show textures from the Jumpscare Mansion. “That…is gonna haunt my nightmares forever.” Spike remarked, he and the others in his team huddling together in anticipation of whatever else would rear its head.
“Trixie does not know why, but she feels quite safe with you holding her like that.” The magician of the group noted when Jet Hex held his arms protectively over her, his horn glowing with eldritch magic. “Oooooh! Shiny! Trixie approves!”
“Heh. Thanks.” He shined his magic brighter, with Moondancer doing much of the same. The increased light would reduce how much terror these halls brought…somewhat. Maybe by a little bit. The terrifying noises echoing through the halls (kind of sounding like creaking and high-pitched crying at the same time).
She took the lead, remembering her vow as the four traveled through the halls…unaware they were being watched. Not only by the various creatures lurking from behind the glass windows, but by several other contestants that would do anything to indulge in their vices, even in the grip of terror.
One that preferred to CAUSE it was slithering around the ground, suddenly rising to envelop Trixie. “Wha-MMMPH?!” The magician was snatched from Jet Hex, her form surrounded by purple slime as it threatened to sufforcate her within. “MMMMPH!”
“Trixie!” The others shouted, Spike’s flames instantly crashing against the slime on instinct. Jet Hex assisted by using his spells to necrotize the slime, causing the stuff to release the magician.
Reduced to tatters that exposed much of her form, Trixie covered her breasts, looking incensed. “HEY! That cloak was a family heirloom, you lecher!”
Forming into the villainous Ivan Ooze, their enemy chuckled. “I was aiming to devour your every bones and flesh just to see how the others would react, but embarrassing you? That’ll do just fine!” His hands crackled with purple energy. “Except it won’t! I want you all destroyed, that’s what’ll put a smile on my face!”
“You’re in our way.” Moondancer coldly said, firing a magic blast to the ceiling and causing a mountain of rubble to collapse atop him, splattering his oozy essence around before she began to run off.
“Retreating?! We have him on the ropes! TRIXIE DEMANDS REVENGE!” She was tugged by her cape by Spike, causing her to let out a yelp. “Hey!”
“You heard her! We have one job! Get to the end, survive, and hopefully not get traumatized more!” Spike shouted, his statement interrupted by the sudden appearance of a cardboard cutout of a cute squid, making him shriek from the sudden noise it made.
“Really, man?” Jet Hex wondered, still running with the group after that.
“I’M UNDER A LOT OF PRESSURE RIGHT NOW!”
“I feel like Trixie is missing a reference here.” The magician wondered, the group not hesitating to run through another door.
With Ivan, he instantly reformed, but then slid under the cracks of another door, hoping to catch up with them or anybody else. “No more Mr. Nice Ooze. This place is a treasure trove of terror. I might make it where I retire after I clear the PESTS out.”
One room that looked like an abandoned laboratory was being visited by Dr. Steel’s group, some of the vats including a few Expendables that Urbanshade had sent essentially to their graves by trying to look for the crystal. Maple shuddered at the sites, not wanting to look at the souls trapped in the tubes.
“Who could be so cruel as to do this?” She wondered, keeping Lonely Shark close while she felt bad vibes all around. She was picking up bad vibrations. Vibrations coming from the ceiling.
Dr. Steel, meanwhile, was looking at the place with mild disappointment. “What’s the point of an evil laboratory if there’s no whimsy or anything? No tesla coils? No killer robots? All I see here is terrible upkeep and a lack of imagination!” He declared.
“I don’t think that’s the problem.” Maple gently pointed out. Her own ears were picking up on a noise or two, increasing her tension. It sounded like skittering…and it was coming from the top…
Droplets of drool fell from a hole in the ceiling, all landing on Dr. Steel’s perfectly smooth head. “…well, this really ruffles my jimmies.”
The last words he would say, as a pair of gnashing mandibles and crushing jaws would pulp his upper body, the other two backing into one of the test tubes in total fear. Maple held Lonely Shark to her large bosum, her fear mixed with protective instincts.
In front of the duo was an insectoid abomination. One that looked like a cross between a spider (particularly the face) and a centipede (the rest of the body). Rearing back, it let out a chittering screech before scuttling towards them, ready to feast further and perhaps feed its brood back at its nest.
Specimen 3 would suddenly turn from the duo, exiting through another hole in the ground, leaving the petrified duo confused before they saw a blue light glowing behind one of the tubes rather brilliantly. Still having danger signals sent to her form, Lonely Shark broke free from Maple’s grasp, pulling her tail.
“EEP! Why the-YIKES!” Thanks to her tail being tugged, she had narrowly avoided a massive kahehameha blowing through the section of lab, burning all in its wake and forcing Specimen 3 to flee further.
Perfect Cell walked through the lab, his hands still smoking as he smirked. “Such a place brings back SO many memories.” He looked at one test tube before smashing it with his fist. “Pitiful science. They should have just given up mid-experiment. Perfection already exists in the form of me.”
He noticed the duo leaving through the nearest door, causing him to smirk. “Times like this, I wish I was in my first form. Weak as it was…I’ll always relish those looks of fear I got.”
While he enjoyed the nostalgia, there would be another room filled with mayhem. Ruby had returned to her normal form, panting heavily before Hama’s tentacles gently rested on her shoulders. “You did wonderfully, hun. I want you to know that.”
“Th-thanks. I think I’ll need therapy after that, but…thanks.” She regained her breathing, calming down even more when she saw the ones surrounding this humble derelict hallway.
Around the rocky terrain, there were these rabbit-like sea-slugs, the creatures chittering with adorable noises as they wandered around like actual rabbits, despite looking more like their sea-dwelling genetic donor. “Oh, no!” Hama giggled. “Don’t come near me! I may want to take you home!”
The palette-cleanser that were the inclusion of these Sea Bunnies was mixed with a bit more hilarity when Squid Baron found himself getting tackled by them. “Ack! Get your feelers off me! I’m a badass video game protagonist! Wonder and whimsy don’t come with those credentials!”
Launch Octopus huffed, dusting his metal off before looking to all three. “Can we PLEASE get a move-on? The longer I stay in this dingy place, the more my metal rusts from the thought. Whoever made this place clearly had no standards for beauty.”
“It’s moist. That’s a plus.” Hama offered. “But the darkness is a turn-off. Let’s get a move on, shall we?” She helped Ruby up, a few Sea Bunnies following them as Squid Baron did his best to look cool.
“Maybe they’re secretly evil end-game bosses in disguise? I’m so full of genre knowledge that it hurts!” He proudly proclaimed.
“Life isn’t a video game, you know.” Ruby pointed out, shuddering after remembering the start of this Arena once more. “No continues, firstly.”
“Oh. So, we’re on Extra Hard mode, aren’t we? Nintendo-Hard, I dare say. One hit and you’re dead!” Squid Baron exclaimed, leading to Ruby face-palming. Hama gave a quizzical tilt of her head, not even sure what they were talking about.
They also weren’t aware that the Drifter and the Beheaded had made it into the same room, the latter surrounded by many of the curious critters after he had taken a moment to rest. “Hypothetically…do these things taste good?”
The Drifter could only shake his head slowly, given how the Sea Bunnies shuddered in fear. “I’m just saying! We might be here for a while, y’know!”
In yet another room, it looked like the top of a large wall covered in darkness, essentially creating a massive bottomless pit. Adam’s “team” was here, the Faunus ready to deal with them if he even caught a glimpse of them or any other combatant. “Revenge…here I come.” He grinned.
“MOVE IT OR LOSE IT!” Jagi pushed pass him, looking like he had suffered a hideous gash across his back. Blood dripped from where he was limping, his panicked cries of terror echoing as he struggled not to fall of the edge.
Instantly raising his weapon, Adam was nearly pushed off himself when Mileena sailed over him, driven mad by bloodlust. “COME BACK! I’ll settle for that monster’s sloppy seconds! Your blood may taste wretched, but I’m open to find out!” She ran on all fours, increasing her animalistic look.
Giving an annoyed snort, Adam tried to take aim again, only to get kicked in the crotch from behind, leading him to wheeze painfully. In contrast to the last two, Juri was calmly walking away from him, grinning. “See you, loser! By the way, say hello to that freak we came across. I’m sure you and her will-“
The whole around the duo began to look like a rapidly moving distorted red/black pattern, silencing the fighter as her taunting evaporated. “Shit!” She hissed, running after the other two while Adam futilely tried to raise his weapon again, his balls hurting fiercely.
It was only after he saw the reflection of another figure on his weapon that he turned around, firing at the featureless mannequin-like spirit that shrugged off the blast. Carrying a large slab of bladed metal in her hands, she slashed at the warrior, which he tried to parry. His weapon was nearly knocked off his hand for his troubles, the implacable Specimen 5 continuing to move closer.
“Damn you!” He shouted, using his Semblance to redirect the parried blows back at the being. That only managed to slow her down slightly…before she resumed her chase, drawn to the inner turmoil of Adam’s mind. His madness had only made her stronger. Strong enough to survive blows that would destroy any other opponent.
Cutting his losses, Adam fled back to where the others went. “This place…was it built to mock me?!” He wondered, instantly disliking the circumstances. How helpless it made him feel. Maybe going further towards victory would change his mind?
In one of the rooms that wasn’t total chaos, Luigi had his head buried in his hands, looking utterly tired after all he went through. “Those poor people…I should have gone back.” He muttered in his guilt, feeling like he was ready to cry.
The terror of that hideous wall of mind-melting energy was gone, but so was his entire team, leaving him as the sole survivor. Now, trapped and alone in a facility that had clearly seen better days, he could only wander the seemingly endless halls, trying not to dwell on what had happened to his comrades.
“No. I have to be like Mario! I have to be brave! I have to remember that this isn’t the first time I’ve gotten through a pickle like this.” The lights flickered around him as he said this, causing him to increase his pace and try to keep his wits about him. If there were any ghosts, that’s what his Poltergust-5000 was for.
Clutching his vacuum cleaner-like weapon with him, he felt watched in every corner, the sound of rushing water against the windows not helping things. A few more spooky noises made him increasingly more jumpy, his shivering getting worse as he traversed the halls.
Little did he know that he was, indeed, being stalked. Springtrap relished slowly moving through the dark halls, steadying his movements so that the poor plumber wouldn’t see him coming. “Almost too easy.” He muttered, flexing his robotic fingers as he neared the trembling hero.
He was so wrapped up in the thought of what he’d do to him that he didn’t notice another frightening figure behind him….until he felt something nick against his metallic exterior. “Ugh. Really?” He muttered.
That exasperated statement prompted Luigi to turn around, screaming in fright at not only the undead bunny man, but the masked murderer that tried to stab between the metal. Michael Meyers had returned, intent on starting his rampage soon after that shaky start.
Punched to the ground by the animatronic-human hybrid, his chest was nearly caved in by a stomp before he rolled out of the way to deliver a stab to one of the mechanical eyes. Not that it stopped Springtrap, who grabbed him and punched him into one of the lockers.
Trying to stay out of the conflict, Luigi had started to run as fast as he could, his mustache standing on end when he felt a ghostly presence. Gripping his Poltergust even tighter, he prepared for whatever was in store for him.
Slamming a door open, Susie Lavoe sliced across his shoulder, trying to aim for his neck. “AAAAH!” Luigi screamed, only to cause the Spirit to come out of hiding, the vengeful one roaring in his face after stabbing her katana into the space between his legs.
Unable to take this anymore, he sped off even faster, tripping against an exposed cable before falling into one of the lockers. Hiding in there out of fear, he was convinced at least one of those killers would find him, his eyes closing in terrified anticipation.
Little did he know that this action would ultimately save him from what was causing the lights to flicker. Something that would not be able to harm the Spirit due to her ghostly nature. She tried to stab into Susie’s body, managing to get her across the back when she tried to run. “Wait! WAIT!” She held out her hands, her injuries severe.
Throwing Michale Meyers to the side, Springtrap cracked his knuckles, but he saw something approaching from the distance. Something smashing all the lights as it floated through the air, letting loose a roar that shook his rotting soul to the core. “Shit!” He leaped into a locker as well, not wanting to be in its way.
Beaten and bruised, Michael was helpless before an utterly MONSTROUS anglerfish-like monster lunged at him from the smoke, the large fangs piercing through his neck before decapitating him and leaving him a bloodied smear on the ground.
He wasn’t alone, as the increased haunted activity had brought one of Angler’s variants to also attack. One that came at a speed that Susie wasn’t prepared for. This Blitz had smashed into her form, slicing through her upper half and leaving her remains to be viewed upon by any who dared to wander the darkened hallways.
After a few tense minutes, Luigi exited the locker, not looking back as he stumbled through the darkness and found himself in a new room. One that only had a vent for him to crawl through. Not thinking twice, he hurried through it, eventually finding himself where some other contestants were.
When he got there, he found a standoff taking place. One in which Gabriel was forming every bladed weapon he could conjure around himself, the Hollow Knight sharpening his nail while Isaac cried due to the violence about to happen.
The one they were facing? A large fish-like monster with a multitude of supplies strapped to his whale-like tail. Growling and looking like company was the last thing on his mind, this humanoid abomination looked ready to thrown down with the group, his jaws dripping with drool.
“You’re a colorful bunch, aren’t you? Too bad I’m not accepting anymore visitors…NOT ANYMORE! NOT AFTER EVERYTHING!” Sebastian Solace roared, rearing up before the whole group.
“You fight us at your own PERIL!” Gabriel declared, his wings nearly turning red.
All Luigi could do was rear back into the vent, his sweat-drenched nose sticking out as his terrified eyes looked at the scene. “Mama mia…”
“Quite.” Meta-Knight jumpscared him by just being near him in the vent, his jumpiness causing him to rocket towards Sebastian like a missile, giving him a black eye.
“OW! FUCK! REALLY, MAN?! REALLY?!” He roared, grabbing Luigi as he gulped loudly. “What do you have to say for yourself before I gut you?!”
Sweating bullets while Meta-Knight joined the fray behind him, the Mario brother gulped down his fears, clearing his throat. “Can we talk?” He gave a beaming smile.
One strained by the fear he was feeling, but it was a start that would cease all conflict…right?
Notes:
Current Dead:
-Sentinel (Team 5)
-Terry Hintz (Team 4)
-Bernadetta Von Varley, Eduardo, Zenitsu Agatsuma (Team 6)
-Siegfried Muller (Team 8)And now...
-Dr. Steel (Team 8)
-Not Spooky (Team 9)
-Susie Lavoie, Michael Myers (Team 11)
Chapter Text
Part 4: The Next Few Rooms
The situation in the room with the giant fish humanoid creature was tense, Sebastian rising up to face the many intruders while he contemplated taking them all on. Even with his freakish strength and assortment of gadgets, he knew that would be a fool’s errand.
“Speak quickly! What do you know of this wretched place?!” Gabriel demanded, still standing protectively over Isaac.
“Wouldn’t you like to know?” Sebastian snarled, sniffing the air before visibly calming. “Wait…you’re not like the others. I don’t smell the stink of my…employers…on you.” He could barely speak that one word without sneering before he examined them a bit closer. “And one of you is an angel? Like the one they’ve got locked up in the depths?”
“Sorry, what?” Gabriel was caught greatly off-guard by that last bit. “What do you-“
“We come in peace.” Meta-Knight knew time was of the essence, so he walked over to defuse the situation quickly. “We were not sent here by choice. All we want is to survive, although some of us don’t mind the extra challenge of facing impossible odds.”
“Present company excluded! I’m in the ‘survive and make it to see another day’ camp!” Luigi admitted.
Tapping his chin, Sebastian sighed. “Okay. You’re not just another Expendable goon sent by Urbanshade. Glad we’ve got that established. You’re just a bunch of poor stupid souls that got wrapped up in this madness. The only good part about this is that it’s FINALLY coming crashing down like it should have years ago!”
While Hollow Knight kept writing this lore down, Gabriel continued the conversation. “I won’t be shedding tears over the fall of this place either, but that doesn’t matter! Tell us all you know that would bring us safe passage!”
“Figured you could use some of that ‘heavenly power’ of yours, but what do I know?” Sebastian wiggled his claws for emphasis. “All joking aside, maybe we can help each-other. I’m ready to pack my bags while this place finally becomes underwater rubble, but there’s this friend that needs saving. Somebody I promised I’d take with me to the surface when we got out of this hellhole.”
“A friend? That sounds nice. Are they in trouble?” Luigi asked.
“Like you wouldn’t believe.” The fish-human hybrid shook his head. “Whatever got into this facility, it’s been turning everything even more upside-down than it already was. I was GOING to enjoy how this was sending my bosses in panic mode as karma bites them in the ass, but my friend got caught up in it. You probably met him when you began your involuntary trek.”
Aside from that hideous wall and the cat from the start, only one thing came to mind for the group. “Was it that computer we saw on the monitors?” Meta-Knight wondered. “It seemed hostile.”
“Yep! That’s the one! Good ol’ p.AI.nter. Kid just wanted to draw landscapes when he got out of Urbanshade’s clutches, but these damn ghosts messed with his processor worse than usual!” He clenched his claws. “Wait until those bastards learn I’ve got a gun that KILLS ghosts!”
Nervously, Luigi showed his Poltergust-5000. “I have something less violent that does the same thing. Does that help?”
“That dinky thing?” Sebastian had to stop himself from laughing. “You look better suited to fix the shitty plumbing here.”
“Enough. This friend…if we find him, will we be any closer to escape?” Gabriel wondered.
“Eh. Sure. It’ll at least make sure you don’t have to deal with…” The angler on Sebastian’s head started to shake, his pupils wavering. “Shit. He’s here. Listening in the walls.”
“Is it a g-ghost?” Luigi shivered.
“Do not let your fear overcome you.” Meta-Knight advised. “You’re better than this. I’ve seen you in combat during the Smash Brothers tournament. Surely, you are more used to this, are you?”
Taking a deep breath, the plumber calmed for a moment…before a tall figure burst through the wall, pinning down a wrathful spirit in their clash. “GAAAH!” Quickly, Luigi hid behind Gabriel, Isaac also huddling behind him.
While the archangel prepared to fight, the Hollow Knight motioned for him to be at ease when he saw who it was. In front of the group, the Pure Vessel was locking blades with the Spirit, the wrathful spirit screaming in its face before it let out a pulse that blew her back, disrupting her intangibility briefly.
Turning to the group, it started to calm when it gazed upon the smaller vessel, leaning down as it recognized the connection to its creator that this knight had as well. “So…before I lose another room I have to settle in…you gonna buy something or what? It’s a fire sale, with the whole ‘collapsing facility’ thing.” Sebastian interrupted.
From the looks of it, this Pure Vessel was joining the group, if only to fight alongside the one that was connected to it. “Are you two brothers perchance?” Gabriel wondered, earning nothing. “Must be both automatons of another force. Whatever the case, onward we go!”
“Rrrrrrr…” The Spirit tried to get up, only to be faced with the Poltergust-5000, causing her eyes to widen.
“Don’t make me use this!” Luigi warned, getting a good look at the state of the specter. “Mama mia! What happened to you?!”
“Ev…ery…thing…” She growled before slashing her blade at him, nearly nicking his nose. “DIE!”
“Do I need to break out this already?” Sebastian prepared his ghost-killing weapon.
“No! I’ve got this!” Activating the vacuum, the Spirit found herself getting sucked into the vortex, bringing the fear of death back into the previously eternally furious being. It was like she was knocked out of an aggressive trance, her eyes reverting back to the ones she had when she was mortal.
Clawing at the ground, she let out screams of mortal terror, causing the lights to flicker even more. “Shit! We just got his attention!” Sebastian yelled.
“Who’s attention?!” Meta-Knight was ready to fight, but the sheer malice exuding from the walls in the form of a glitch mass of green energy was causing him to slowly change his mind.
“THAT! NOW, GO! Tear this place apart if you have to! Help my pal and I help you!” Sebastian started to slither away, taking his items with him.
Letting go of the Spirit, Luigi ran after them, not wanting to stick around either. “Sorry about that, ma’am! Stay safe, not spooky!” He hastily stated, fleeing the scene through the hole in the wall.
Being momentarily knocked out of her rage caused the Spirit to waver, before she took a hint and fled the even greater spectral presence that was leaking through the walls. It wasn’t alone either, as an army of spirits had begun a hideous process. One that took advantage of the scores of dead left in the wake of Urbanshade’s evil.
Countless Expendables, all having fallen before the horrors of this facility, were rising up, possessed by a recreated ghostly army that Spooky once tried to make. Their eyes glowed green as they possessed the corpses, indicating that it wasn’t Spooky directing them. It was something else.
Something that seemed very intent to keep its employers happy, no matter the cost.
That same army was showing up in various rooms, like one that looked like an abandoned space station. Yet another segment of the Jump Scare Mansion that had been merged with this place as a result of the Paradox, the scuttling of Specimen 3 still patrolling the ceiling.
Waiting to strike at any minute…
Anyway, that army was roaming around the place, some floating through the air as they prepared to ‘clean up’ everything that wasn’t supposed to be in the facility. Even the very walls were getting clawed at, like everything that wasn’t a part of the original blacksite was something meant to be destroyed.
Several kicks would send parts of his undead army against the walls with enough force to nearly knock the spirits out, Juri Han having been the one to accept their challenge. “A zombie apocalypse?! How cliché can you get?”
“They don’t even taste that good!” Mileena exclaimed, stabbing her sais into one of the corpses, only for spectral energy to come pouring out instead of anything that one would expect. “Let’s make this interesting! Keep score! Just be content with the knowledge that you’ll lose!”
“Oh, it’s on, bitch!” Juri grinned, avoiding the knife strikes of one Expendable before slamming her foot down on him, using her other one to bowl over another group. “That’s five more!”
“TEN!” Mileena roared, sending magical projections of her sais through the heads of several more of the undead.
While those two had their moment, Jagi was rushing through the facility in search of an exit. “Shit, shit, shit! Where the fuck is the way out?!” He may have been insane, but he wasn’t stupid. A whole army of beings that didn’t fear him on sight was bad news. None of his usual tricks would be able to keep him alive for long.
Smashing through the one of the walls was Cobragator, but something was different about the creature. It seemed like it was heaving and drooling a lot more, like something was deeply wrong with it. Adam had just finished slicing across various parts of the tough armored hide, kicking off its head as he prepared to keep fighting. “Disgusting beast!” He declared.
Rearing up, the behemoth let out a guttural roar before part of its throat began to expand, the eyes going blank before something emerged in a shower of green fluids, killing the contestant for good. Much to the horror of both Adam and Jagi, what came out was infinitely worse.
It looked like a pair of human legs with tentacles emerging from everywhere else, the parasite-like Specimen 10 having made itself known. Moving at a speed that blinded even Adam, it smashed those tentacles into his body, sending him flying across a hallway. “You guys have fun! Guess that freak’s having dinner time!” Jagi ran for the hills, content to leave behind his foe.
“Grrrgh…human bastard!” Adam roared, ignoring his own pain and the way his vision was looking a lot more yucky thanks to the toxins of the worm-like abomination. One that kept chasing after him with great speed in order to infect him more.
Holding Lonely Shark close to her massive bust, Maple did her best to not reveal their location in the chaos. The sound of that parasite moving around, along with all the possessed Expendables, wasn’t doing wonders for her fear. “Oh, Herald…what would you do in this situation?”
“Mmmph…” The shark-like being within her breasts snuggled further, finding it quite safe within the soft large confines.
Already seeing a door, Maple didn’t hesitate to rush towards it, only for something to instantly burst free from the walls. A humanoid figure had knocked her down, seemingly made out of the very same material the wall was made out of. It also had a cardboard cutout of a cute squid creature on its face, though it seemed to be wriggling with fear at its circumstances.
Indeed, many copies of ‘Specimen 1’ had found themselves becoming a part of the dreaded ‘Wall Dwellers’, one of those creatures ready to start beating on the poor draconic being. “EEP!” Out of sheer panic and still holding Lonely Shark close, she unleashed a stream of flames right into the fiend’s face, causing it to let out several high-pitched whimpers and run away.
Getting up quickly from that, Maple panted heavily, with her companion having to tap the massive bust to get her attention back to escaping. “Oh! Yes! It’d be nice to be anywhere but here!” She nodded, rushing towards the door to who-knows-where.
In yet another part of the Blacksite, Moondancer was planning an ambush, hiding behind one of the lockers as she saw Velora’s group enter. “Feels like I’m trapped in one big shark cage.” The Megalodon anthro growled before her gills started to expand. “Something’s up.”
Indeed, something was lurking within he waters outside the nearly-broken windows. Yet another shark, but one that could better be described as an absolute monstrosity. Already, a strange voice started to infect the minds of the trio. Something that sounded pleading, yet also wrathful.
Don’t you want to look at me? I have such beautiful things to show…such beautiful things…just look into my eyes…LOOK INTO MY EYES…
“Uh-oh! Duck!” Big pulled Velora by the tail, resulting in her and Lindsay hiding behind a piece of rubble as something huge passed by the windows, lured in by the corrupted p.AI.nter’s signal. It looked like an oversized bull shark, but it had a series of horribly misplaced green eyes all over its body. How fitting its name was Eyefestation.
This abomination of science, lashing out against a world that maimed it like this, circled the waters, knowing that there were others in this hallway to trap and destroy. Moondancer’s group was hiding in the lockers at this time, all awaiting what move to make with this thing circling with radioactive eyes.
“We’ve got a short time window to make it to that door. If we just move quickly…” Spike began.
“Maybe I can use a blinding spell?” Jet Hex wondered. “Something to disorient it.”
“What’s so hard about not looking at that repulsive thing? Trixie considers it an easy challenge! She wouldn’t want that in her nightmares any day!” One locker shook with the boasts of its occupant.
But Moondancer wasn’t in here just to keep running into rooms and hoping for the best. Narrowing her eyes, she concentrated her magic to form some kind of distracting image. She was aiming for something to scare Big’s group out of hiding, but what she wound up with was-
“Froggy?!” Big exclaimed, seeing a vaguely frog-shaped construct on his side. “I’m coming!”
“Wait! Hold on, big guy! That’s a-“
Too late. Velora’s cries fell on deaf ears when the cat mobian rushed to that construct, only to wind up in the crosshairs of Eyefestation’s stare. “Oh! Hello! Sorry about…about…” His words began to trail off when the construct not only fell apart in his hands, but he began to melt into a puddle of radioactive goo as eyes started to appear all over his mutating frame.
“Not the cute kitty!” Lindsay could hardly look, while Velora did her best not to barf, her eyes frantically looking for an exit.
“EVERYBODY! START RUNNING!” Moondancer yelled, forcing everybody out with a magical burst.
Despite being appalled at what his ally had done, Spike and the others knew it was better to start moving before the shark-like monster moved onto some new targets. “PEACE OUT!” Trixie shouted, firing a blinding spell alongside Jet Hex to distract both the other team and the shark-like monster.
But p.AI.nter wasn’t just utilizing the wrath of the mutation to attack. Letting out a giggling laugh with glitches stating ‘HELP ME’ in the middle of it, the machine activated some turrets, bullets flying through the blinding light and randomly striking anything they could find, even the glass holding back the supremely pissed Eyefestation.
That sent everybody into a running flurry…but not everybody made it in the melee. “TRIXIE!” Jet Hex had noticed how his friend’s hand went limp, her arm having been struck.
“GAH! Trixie is fine! It is merely a flesh wound! I_
Her body was suddenly pushed back by Moondancer into the same place Eyefestation was, distracting the fiend. “Forget her! She’ll only slow us down! Keep going!”
“What the actual BUCK, Moondancer?!” Spike shouted, but both were shoved through the door as the shark-like mutant unleashed its stare onto Trixie, the stare working even faster after that previously blinding. The stare was blood-red, just to emphasize how much she was doomed, everybody else making their escape.
That wouldn’t be the only hallway filled with raw terror, as evidenced by when Ruby Gillman’s group had to hide within some lockers when another anglerfish-like monstrosity moved about. The double-bouncing thing known as Froger, that is. Twice, it would patrol the halls, keeping the others hiding throughout.
“This is ridiculous! I should be out there, destroying the opposition in all of its ugly ‘glory’!” Launch Octopus’ locker shook with indignation.
“You trying to get us killed by the insta-kill enemy right now?!” Squid Baron’s locker also shook. “Shut up! We’re in the obligatory stealth segment.”
“Isn’t that the whole thing when you think about it?” Ruby’s locker shook a little less, but still with noticeable fear. She was well aware that there were things in the deep sea best left undisturbed. THIS was not among those things she expected. Perhaps following Squid Baron’s video game logic was working, though?
For the beast didn’t even try to look in the lockers. Neither did its incredibly quick follower, the Pinkie. “What a pretty glow!” Hama chuckled, stepping out of the locker when all was said and done, but she also had a pretty large bra held in her tentacles. “I don’t mean to pilfer, but this is just my size! I’m sure whoever wore this first won’t mind!”
Blushing at that sight, Ruby used one of her own tentacles to put it back. “Maaaaybe they’re okay and they’d be really sad if we just took their stuff while dealing with this life-scarring nightmare?”
“Oh, come on! Whatever happened to following my flawless logic?!” Squid Baron stepped out with plenty of loot, like papers and batteries. “I have no idea what any of these are used for, but anything goes!”
“Let’s just leave it. All of this is so…disgustingly primitive!” Launch Octopus haughtily said, tossing away the batteries. “Who uses Double-A batteries in the year 200X anyway?!”
Two others had decided to follow their example, albeit reluctantly. “Whatever happened to just hacking and slashing one’s way to victory?” The Beheaded groaned, some Sea Bunnies still on him as the anglerfish-like monsters left the scene. “You know what I’m saying, terminally ill friend peasant?”
Within the locker containing the Drifter, blood and greenish ooze began to seep out, causing the Beheaded to step out and open the other locker in concern. What he saw made him nearly retch. “Oh, that’s not good…”
A Puddle of Void Mass had not only begun to consume the poor hero, but it was joined by a hideous slime-like specter floating out while making gasping moans. Specimen 2 had merged with several of these lockers, gaining more power and becoming MUCH larger than normal. Spreading his arms out, he brought them down, spreading more of that slowing slime.
Using his trusty frying pan, the Beheaded struck the horrific entity, but that only spread more slowing slime everywhere, tentacles erupting from the locker to try and grab him. “NOPE! I’m not becoming the lunch of some puke monster today!” He exclaimed, wisely deciding to book it after several more blows proved fruitless.
Alas, Specimen 2 was now on the move, eager to chase after somebody new to consume, while still being empowered by more lockers containing the Void Mass that had connected to him so well.
But all of those happened paled in comparison to the all-out war taking place in a room that resembled a classic creepy abandoned mansion. Usually, this sapient mansion (Specimen 12) would use a poor possessed vlogger to chase around the inhabitants with a large sickle, but there was no way this mansion was even remotely prepared for what was happening now.
An all-out war between Warpath’s group (PUN!) and V1! The blood-powered machine was running through the rooms, tearing up the place while the mansion frantically tried to restore itself. “KA-BLAM! POW! BOOM!” Warpath’s tank mode was crashing through walls, attempting to land a shot on the machine.
“Warning: I would advise actually aiming!” Legion stated, only to nearly get his arm destroyed by a blasted coin. “This machine’s aiming prowess is…incalculable!”
“More like messy! Just the way I like it!” Kleo fired her lasers to force the flying machine into swerving more through the air, only for two extra arms to show up on the robot and him to unleash even MORE shotgun blasts. “Give me a second to breath, honey!”
“So many explosions! So much mayhem! BOOM! WHAM! Party like it’s the Golden Age of Cybertron, folks! WARPATH, TRANSFORM!” Turning into his robot mode, the Autobot grabbed the robot, only to get blasted in the face. “OOF! OWIE!”
“GET REKT, SCRUB.” V1 stated, blasting an entire library to nothing when attempting to fire at a running Legion. The Geth was struggling to find a spot to hide and blast from afar, but this other cycloptic machine was relentless.
Firing a grappling hook to try and get to the Geth, it would snare with Pathfinder’s, the two machines crashing into each-other. “Oops! Sorry about that! I’m afraid we have to get into fisticuffs galore if I’m to protect my friends!” The kind-hearted robot stated before punching V1 across the head, causing it to spin around.
“GOTCHA!” Warpath thought he had a clear shot, but a blast of evil energy smashed into his barrel, blackening it as he stumbled. “NOOOOOO! THE HORROR!”
Ivan Ooze rose from a massive puddle of his own essence, laughing as he blasted at the chandelier, forcing V1 and Pathfinder to disengage so it wouldn’t fall on them. “Nice place we have here! Too bad I have to wreck it while I cut your chords, you useless toasters!”
“Oh, no, you didn’t!” Kleo fired a powerful eye laser, knocking him in the chest, but he shrugged it off, burying his arms into the ground and forcing his limbs through the wooden floors, punching through various areas to torment the team.
Warpath was hidden in a corner, whimpering as he held his barrel. “My baby! Glitch if it hurts!” Sparks flew out of it, causing him to weep further.
“Oh, poor you.” Pathfinder gently said, patting it before something began to pull at Ivan through the floors, causing him to let out a surprised gasp before he was pulled under, slime and all.
Hesitantly, all robots looked over to see the massive hole forming in the floor, V1 already looking ready to continue the fight…only to realize that, given the lack of blood, he was running VERY low of health. “PEACE OUT!” He boosted himself towards the next door.
Looking for somebody to pound after the harm done to his cannon, Warpath pounded the ground, pointing to the fleeing robot. “GET HIM!” He commanded.
“Oooh, getting dominant and angry, aren’t we?” Kleo teased, getting atop his shoulder as he rushed towards the door, the other robots following.
Deep below, there were a series of underground catacombs, tight and dark and now filling with water. There, Zardy was continuing to ride atop the Nightshade Paolumu, the creature being pacified by feeding on the mushrooms that grew in the place. “This is an even bigger maze than my home! Where’s the exit?!” He asked in frustration.
“And is there no end to the surprises?! Those cardboard cutouts spooked me!” Kogasa exclaimed, sweating nervously before they heard a horrible guttural noise. “EEP! The shoe’s on the other foot with me today, isn’t it?”
“Quiet! Something is coming!” Zardy yelled, readying his hoe, while the Nightshade Paolumu prepared to back away, as if sensing that a bigger predator was ahead of them.
Oh, yes. A much bigger predator was rampaging through the rocky halls, tearing through the place and causing it to cave-in. No longer bound by a single room in the blacksite, it was taking advantage of its freedom quite nicely, approaching the trio with malicious intent.
Smashing through one of the walls and causing the light of the mansion to enter, a hideous mass of flesh and some of Ivan’s oozy frame was standing before the group, the most defining feature being two large clawed arms and a mask-like face, the assimilated pile of horror letting out a hideous laugh as Ivan’s face slid around the body, laughing in unison.
“Hey, folks! Met my new friend?! We’re going to tear this place apart, starting with you losers!” He exclaimed, the Good People slamming its arms down as it prepared to fight.
Hopping back in panic, Kogasa unleashed a stream of water orbs from her umbrella, smashing them into the mask-like face of the abomination. Zardy knew the fight would not end in their favor, so he elected to flee. “Go terrorize somebody else! We’re out of here!”
“But I’m so sick of being surprised! I want to do some surprising! My self-esteem is hitting rock bottom!” Kogasa whined, only for a massive claw to nearly get her, as well as an oozy tentacle. “Nevermind! Maybe the real surprise is us staying alive!”
“I couldn’t agree more.”
Floating down to the massive hole in the mansion was Perfect Cell, the smug android gazing down at the horror before him. “I can’t say I like the new look, Ooze. I liked it better when you looked like your typical pathetic self.”
“Why don’t you say that to my face, you oversized cockroach?!” Ivan shouted, a series of oozy tentacles rising from the Good People’s form, the mask looking even more malicious as it looked upon those it could absorb further into its form.
Charging up a Kamehameha, the android intended to end this quickly. “I’d much rather BLAST your face into atoms! PREPARE FOR HELL AND MY ULTIMATE VICTORY OVER THIS BLASTED GAME!”
Deep within these catacombs, Springtrap was stalking, his glowing eyes piercing through the dark. “Never thought I’d say this…but I could really use a light.” He was used to darkness. Not ADVANCED darkness.
“RUN FOR IIIIIT!” Kogasa shouted, passing by the undead killer, the Nightshade Paolumu unleashing a gust of air to propel the trio out of there and knocking Springtrap onto his back.
Growling, he slammed his fists against the ground, intending to get back up and menace the trio of potential victims. “Of all the stupid-“
SHOOOOOOOOM!
A massive beam of blue energy passed above him, his body freezing up as he looked upon the sight with terror. Once it was over, he slowly stood up, his joints shaking. “I…hate…this game…” He mumbled, only moving again when the tunnel began to collapse from such an attack.
Notes:
Current Dead:
-Sentinel (Team 5)
-Terry Hintz (Team 4)
-Bernadetta Von Varley, Eduardo, Zenitsu Agatsuma (Team 6)
-Siegfried Muller, Dr. Steel (Team 8)
-Not Spooky (Team 9)
-Susie Lavoie, Michael Myers (Team 11)And now...
-Cobragator, Big the Cat (Team 1)
-The Drifter (Team 3)
-Trixie (Team 7)Also, sorry it took me this long to make this chapter! Was super busy!
Chapter Text
Part 5: Even More Rooms!
Even with Specimen 12 utterly demolished by the havoc happening beneath it, the battle between Perfect Cell and the Good People raged on. The mass of flesh and parts of Ivan Ooze rose through the inferno, the portraits on the mansion seeming to scream as the entity found itself dying in the blaze.
Extending many tentacles through the mansion in an effort to grab the android, the Good People’s mask distorted to show rage as he kept missing, the villain being so incredibly fast that it looked like he was teleporting. Stealing a technique from Tien once more, he created several copies of himself, distracting the entity even further.
“Maybe I’m here? Or here? Or maybe here?” Cell taunted, firing a few ki blasts to annoy the entity further.
“GAH! Will you STOP already?! Let me show you how a REAL villain fights!” Ivan’s face started to warp around the Good People, taking over the entire mass as its form turned bright purple and sickly. The mask atop it started to resemble Ivan’s face even further, despite the entity thrashing around and trying to resist it all.
Rising up on two new legs, the Ivan People smashed some new fists through the walls of the mansion, the environment trying to hastily rebuild itself. Purple eye beams and blasts of lightning filled the whole room, the mouth of Ivan expanding to try and swallow Cell.
Smirking, the android flew right into the mouth, confident in a strategy he came up with to end the rampaging ball of ooze and tormented souls. “MMmmn…” Ivan swallowed the massive lump, giving a loud burp. “Hey! There’s a hint of mint in-“
Suddenly, his body began to expand, a Super Explosive Wave generating within the very core of his being. “Should…have…chewed…before I swallowed…” Ivan muttered, the mask making up the original Good People’s form starting to crack as ki beams emerged from the expanding form.
Outside of the Blacksite, a being of green glitchy energy watched as a whole segment of the place went up in flames, causing water to start rushing into that one area. Clenching his fist, the portion was suddenly rebuilt, but there were still cracks in there, indicating that his control over the place was waning.
The paradox would not spare anybody, not even the plans of whatever this enigmatic ghostly entity was.
Perhaps it was through his involvement that the ghostly ‘Anglers’ were going haywire, the lights of nearly the entire forbidden facility cracking and glitching out like crazy as they perused the hallways, seeking out prey in the form of those that dared come close to figuring out a means of fleeing this horror.
Luigi’s group was that unfortunate group…but they weren’t like the hordes of Expendables that were sent here. They were a LOT more capable of defending themselves, as evidenced when a seemingly unbeatable Pinkie was suddenly sliced in half when it rushed at Gabriel, the angel’s light slowing down the fiends considerably.
“May the light of God SMITE YOU ALL, YOU FUUUU…foul fiends.” He realized Isaac was nearby, causing him to calm down with his approach.
Speaking of which, the seemingly helpless child was using his tears to undo the smoke created by the slower but still foul Chainsmoker, the rest of the smoke getting dispelled by Meta-Knights tornado attack. “Begone!” He shouted, slicing through the gaseous entity.
Sliced into many pieces, the gas tried to reform those pieces, only for the Spirit to stab her blade into the very soul of the being, though a Blitz tried to rush at her. “LOOK OUT!” Luigi shouted, using his Poltergust-5000 to stop the fiend right as those teeth were close to the Spirit’s face.
This showing of mercy further clouded the Spirit’s previously furious judgement, her face adopting a softer look, her eyes even looking like they used to as they gazed upon the plumber. In fact, time seemed to slow as she watched the obviously frightened one toughen up and start to lay the smackdown on the viperfish-like entity.
Multiple times, that creature was slammed down, the black essence making up most of its body getting sucked up until all that remained was the organic parts, which flopped onto the floor, lifeless. Panting, Luigi gave a thumbs-up to her. “Glad to see you’ve calmed down. Feeling better?”
Rubbing around her sword, the Spirit tried to reconcile the conflicting feelings in her form, but her rage would be satiated when another Blitz tried to attack, only to get stabbed right through the face, black essence leaking from the wound before she started to go to town on the monster. “Eesh.” Luigi winced, joining the others.
The Hollow Knight and the Pure Vessel proved to be an unstoppable duo, the smaller one avoiding many rushing attacks, which left the monsters of all kinds susceptible for the Pure Vessel to either destroy them with either pulses of light or a rain of ghostly swords. “Today, we taste victory! WE TASTE JUSTICE!” Gabriel boasted.
“That’s right! But don’t let your excitement spoil your concentration!” Meta-Knight flew alongside him, teleporting to strike an incoming Frogger that missed them previously and tried to get at them again.
Using his Poltergust-5000 on yet another Angler, Luigi was dragged into a shadowy room, a Wall Dweller with a skull-like Specimen 1 on its face suddenly emerging. “YAAAAAAH!” He cried out, the jumpscare causing him to step back in terror.
That creature was suddenly smashed into the ground by Springtrap, the undead being crashing his foot against the being’s back before glaring at Luigi. “Let me show you what a REAL scare is like!” Grabbing a sharp piece of rock, he let out a horrific scream before leaping at the plumber.
“YIPE!” Leaping up in terror, he jumped just high enough that he avoided the attack, leaving Springtrap to face Isaac.
Getting up, he easily made the boy cower. “You won’t be the first brat I’ve silenced!” He boasted, the boy quickly unleashing a stream of tears at this enemy. “Hah! What’s this supposed to-GAAAAH!”
The tears began to fry parts of the animatronic that still functioned (if barely), resulting in him doubling back in pain. “Cute trick, but that won’t-GURK!”
Obviously, Gabriel had not taken kindly to Isaac being threatened, the angelic warrior twisting one of his conjured blades where the heart of the villain should have been. “The evil you have…I could practically SMELL it just by being near!”
“Grrrrk…this…isn’t…ANYTHING TO ME!” Grabbing around Gabriel’s helmet, he tried to clench, even as he was flown into the air, slammed back into the ground before a blast of light sent his upper half hurtling into a locker, denting it before he landed down, trying to crawl forth. “I always…come…back!”
“Come back from THIS!” A massive beam of light landed right on top of Springtrap, his screams echoing through the halls as he was vaporized. Gabriel put away his weapons, crossing his arms as Isaac clapped his hands. The sight of somebody being grateful for his help made him almost lose sight of his vengeance against V1.
‘That machine is still out there…but, for now…this is nice.’ He gave a chuckle as he floated down to give the child some comforting pats to the shoulder.
“Right this way, everybody!” Luigi led the charge, though Hollow Knight sped towards the exit first, eager to continue the journey while spamming his zooming abilities. The Pure Vessel opted to just spam his teleporting abilities. “Heh. Reminds me of when me and my brother used to race.”
“I’m sure Mario would be proud to see that you are still facing your fears and emerging victorious.” Meta-Knight offered.
Rubbing the back of his head and blushing bashfully, Luigi shook his head. “Aw, shucks! I just hope I can finally conquer my fears one day!”
“One often never does. They just face it. That’s all that matters.”
Hearing that, Luigi rubbed his chin. “Can I honestly consider you a ‘villain’ anymore?”
“Morally ambiguous. Let’s leave it at that.”
Right when the Hollow Knight opened the door, a foot kicked him in the face, several slain Expendables falling out of the place before Juri leaped into the halls, licking her lips. “Hope you boys have laid out the welcome wagon!”
“Because we’re far from done!” Milleena removed her mask to lick her blades, letting out a screeching roar as she rushed towards the group.
Instantly, the Pure Vessel let out a silent but powerful scream, creating bursts of light. “How disappointing! No blood to feast! I’ll settle for reducing you to ribbons!” The Tarkatan-mutant fired her sais at a corner, causing them to reflect right into the being’s back, interrupting a sword swing before she pounced on the tail being, chewing at his mask.
“UNHAND MY ALLY!” Gabriel teleported, only to get kicked in the head by her heel. “AUGH!”
“Head’s up!” Juri landed her foot against his head as well, knocking him down before she avoided a slash from Meta-Knight, doing a cartwheel kick to face him. “Think you’ve got what it takes, you goth half-pint?” She arched a brow. “Seriously, what ARE you?”
“I’d be your doom…but this is not my fight to win. It is his.” He calmly wrapped his cape around himself, assessing the injured allies.
“Huh?” Her cheek was suddenly cut when the Hollow Knight extended his needle, doing a shadowy ground-pound that knocked her onto her back. “Oh, you, little cockroach? Don’t make me laugh!”
Meanwhile, Mileena was about to go in for the kill with Gabriel, but the Spirit surged before her, clashing her blade with her sais. “Fighting a ghost? That’s new! Not even my dear sister has ever done that!” She marveled. “Ready to die TWICE?!” She used her own form of teleportation to ensure the Spirit would miss when she tried to phase through her, firing her sais to knock her weapon away.
Her back was slammed into when Luigi did a flying headbutt, knocking her down, but she sprung off the floor and landed on the plumber. “Uh…hi?” He waved, sweating nervously as those sharp teeth hovered over his face.
“That nose looks so chewable!” She licked it with delight before his savior came in the form of the Hollow Knight sending Juri flying with a charged strike with his needle, cracking her chest-plate armor before she and her ‘ally’ tumbled on the ground.
That attack was also combined with Isaac’s tears, causing the floor to be slippery and increasing how much Juri was struck onto the floor. After that was done, Isaac held out a hand, waiting for a high-five from the hollow being. The Knight simply gently pressed his needle against his hand, not sure what to do with that gesture. Something that Isaac was still content with.
Punching the ground, she got up alongside the savage kombatant, but they saw that they were being outnumbered. “You think…you freaks are tough?! I’m not done! I’ll fight until I can’t stand anymore!” She madly declared. “Actually, I’ll bite your freaking legs off if I can’t stand!”
Mileena sniffed the air, smelling something was off. “Wait. There is somebody else-“
“LET’S FUCKING GOOOOO!” Juri’s right eye glowed with even more power, her muscles flexing and causing her partner to blush upon seeing that.
She and the others should have heeded Mileena’s words, as Moondancer had arrived through a different door, getting a plan. Her horn began to glow, concentrating to the point in which her bones ached and her body felt like it was burning up. “I’m not done talking to you!” Spike declared. “The way you just left Trixie to die-“
“RRRRRGH…” Her muscles flexed to horrifying degrees, veins appearing all over her form.
Jet Hex was the one that wanted to chew her out the most, but he was now realizing just what she was doing. “Wait a sec…” He noticed how the walls of the hallway were bending, the windows starting to crack. “OH, SHIT! MOVE, MOVE, MOVE!” He declared, grabbing Moondancer as she continued her spell, he and his draconic companion running as fast as their legs could carry them.
It all became very clear. The unicorn wanted this game finished quickly, the walls starting to collapse and the windows shattering. “SCATTER!” Meta-Knight shouted.
“Right away!” Luigi declared, his group fleeing to any door they could find as the place began to crumble.
“Huh?” Juri was the last to notice something was wrong, coming to her senses one last time before the Pure Vessel caused several blades to emerge, stabbing her legs as well as Mileena’s. “AUGH! BASTARD!”
“NonononononoNOOOOOO!” Mileena screeched, the two crushed by the rubble and the pressure of the water that started to flood in. With that, another section of the Blacksite was destroyed…and it wouldn’t even be the last during this part of the story!
In another hallway, Specimen 2 continued to chase after the Beheaded, the hero throwing everything but the kitchen sink at the spirit continuing to hound him. “Seriously! What do I gotta do!? Throw a bunch of cleaning supplies at you?! One can of bleach and you’re going down!”
While running, he skidded to a halt when the next room revealed a bunch more Possessed Expendables. Some of them looked like they were in terrible shape, yet they kept fighting, the spirits within them keeping them from finding rest.
Ruby’s group was handling them, the massive Kraken being in a spacious-enough place so that her tentacles could knock scores of the undead away. “Sorry! Sorry! Really sorry! OUCH!” One of her tentacles was stabbed into, causing her to fire her eye beams. “Slightly less sorry!”
“Stop apologizing and start concussing!” Squid Baron demanded, throwing every single one of his items at the horde, which did little to slow them down.
Hama ripped several locker doors off, using them like makeshift shields as she used her tentacles to slam them down on the fiends. “Zounds! You’re that strong for an organic?!” Launch Octopus wondered, firing several fish robot-like missiles from his tentacles at the horde.
“I work as a blacksmith, dear! It comes with the territory!” Swinging around the doors, Hama never lost her smile as she continued to absolutely demolish the evil forces.
The Beheaded had an idea when he rushed into the crowd, pushing past the undead and smacking many of them away with his frying pan. “Out of the way! Move it or lose it! Coming through!” He was intent on making it to the door, eventually running across Ruby’s tentacles before landing on her head.
“Can I help you?” She wondered, firing her eye beams at another swathe of undead.
“Sure, giant squid lady! Just tell me where the exit is and…oh, that was easy! Gotta go! Good luck with the evil slime ghost!” He slid down her hair, swinging on it like a vine.
“Ow! Easy with the split ends! Wait a minute. Did you say-“
A horrible gasping noise got their attention, the Void Mass accumulating in front of them until it revealed the top half of Specimen 2. The grasping hands were enveloping various Possessed Expendables, making their forms a part of it as it grew larger and larger.
“Mommy…” Squid Baron whimpered, while the others prepared to fight.
“I refuse to be undone by mere SLURRY!” Launch Octopus declared.
The doors to the other side suddenly opened, but the ones at the other side knocked the Beheaded onto his back, the Sea Bunny atop him huddling around the mass of flames that made up his head. “What the-?”
“ZOOM! INCOMING!” Warpath transformed out of his tank mode to hit the scene, accompanied by the other three robots part of this group. “Hey, look! Calimari and a giant booger!”
“What else will this place come up with next? There’s so much to see!” Pathfinder exclaimed, using a grappling hook to avoid one of Specimen 2’s claws. “If only I had a video camera!”
“And if only I had a bigger eye laser!” Kleo declared, firing various blasts at the monstrous entity.
Ruby had to duck several times, while Legion took aim at the toothy ghoul’s head, but all bullets and other projectiles were merely phasing through the abomination. “This is officially out of control!” Ruby declared, covering her head.
Using the locker doors from earlier, Hama made a makeshift shield around her, keeping both the slime and remaining Expendables away. “Don’t you worry, dear! I’m sure something will come up to save us all!”
While the group fought valiantly, Pathfinder poked Launch Octopus’ shoulder. “Do you mind?! I’m busy, you poorly designed fool!” He shouted.
“Sorry! But you wouldn’t have happened to see a one-eyed winged robot pass by? He kind of hurt my friends, so I’d like to know!” He cheerfully replied, ignoring the ex-Maverick’s response.
“Does he look like that?” The Beheaded pointed to the glass window, a radioactive glow approaching the place fast. Even Specimen 2 was distracted long enough to stare in dawning horror at the sight.
Eyefestation was returning, but all of its eyes were closed in a mad panic, the jaws biting everywhere as a certain robot rode atop its fin like a cowboy on a bucking bronco. “1010101010101!” V1 kept shouting, making sure the giant mutated fish was headed for the faulty walls.
“Wel…shit.” The Beheaded slumped his shoulders, the others having barely any time to brace for impact.
SMAAAAASH!
The ensuing riptide of ocean water pushed everybody through one of the hallways, the walls coming down as they were dragged by the force of the current. Ruby’s group was more accustomed to the water, so they swam with it once they got their bearings, using it to make it further through the facility.
Even the robots were doing their best to hold onto something, unable to keep fighting with this pulling them in all directions. Warpath, in particular, held his allies close as his weight ensured he could at least control himself a bit more as he was tumbled around.
The only one that didn’t benefit at ALL was Specimen 2, the spirit letting out one last moaning gasp of horror as it dissolved in the pure ocean water, the Void Mass torn apart by the current. The Beheaded flipped the fading substance the double-bird, his Sea Bunny swimming with the current harmlessly.
In much calmer news (well, comparatively), Zardy’s group was dealing with a whole other threat in one of the series of rooms that resembled the old Jumpscare mansion. Stone made up the walls, torches lighting the way as the scarecrow continued to ride upon the Nightshade Paolumu.
“How long does this place go?! This is making my maze seem conservative!” He groused.
Kogasa was even more sure there’d be surprises around every corner, but she decided to think positive. Maybe she could learn a thing or two from such a scary place? She held her umbrella close, anticipating the next surprise, but, instead, she and her group would bear witness to one taking place.
Adam and Jagi were at it again with their usual antics, trying to kill each-other, but also being menaced by whatever else this horrible place had to throw at them. In this case, a freaky puppet that kept descending down to attack them when their backs were turned.
“CUT THAT OUT!” Jagi shouted, using his shotgun to threaten the puppet back upwards, yet it kept coming down, slashing at him with needles. “That’s my thing!”
“Forget him! Focus on me, you wretched human!” Adam used his own shotgun attacks to throw Jagi off-guard, the man using his martial arts training to move faster than those blasts and deal a series of vicious blows to him.
“I’m gonna rip those horns off and shove them down your throat, you masked freak!” Jagi declared, while Specimen 6 booked it, not wanting to risk anymore injury when Adam unleashed a slash created from the accumulated blocked blows.
That blast sent Jagi flying back, earning him several new scars when the slash-mark appeared on his chest. “I’m a freak? Have you seen your own face?”
Hearing such a specific insult thrown back at him caused Jagi to let out a primal scream of fury. “You…YOU’RE FUCKING DEAD!” Punching at the foundations of the room, the place began to shake, chunks of stone falling. “EAT SHIT AND DIE! I’m not wasting my time with you anymore!”
“Get back here! Stop running and face me to the end!” Adam declared, chasing after Jagi once more.
As the place crumbled, Kogasa and Zardy looked at each-other, the yokai arching her head. “Why do humans fight all the time? Can’t everybody just learn to get along?”
“Eh. Not our problem. Let’s keep going.” Growing a piece of corn from the mass of plants that made up his body, he used the ‘carrot-on-a-stick’ trick to have the Nightshade Paolumu keep moving through the rooms, the trio having avoided yet another horror this paradoxical place ahd to offer.
For those wondering if the aphrodisiac flow would cease with how chaotic things were getting, proof of that not being the case would be found in what seemed to be an abandoned fast food eatery. In spite of how creepy and dilapidated the place was, the aphrodisiac was flowing so much that one group would ignore the red flags this brought.
Velora was in total bliss as she felt her tits get massaged by the busty dragoness below her. “Fuuuuuck…this ‘Herald’ guy doesn’t know what he’s missing…you’re fucking PERFECT…” She grunted, her balls dragging across Maple’s soft scales as her two cocks were massaged.
Moaning, milk began to leak from Maple’s tits as she laid on her back, her hands grasping at her boobs. “Are you…sure?” She mumbled. “I am so fat…so disgusting…I am not worthy…AH!”
“I dunno. Linday agrees with me.”
Indeed, the blonde found herself slurping around those massive tits, her lipstick staining the full nipples as she cuddled her nude form around the larger being. “Mmmmmn…creamy!” She beamed. “Not as tasty as the stuff that comes out of Tyler’s cock, but still great! Do all boobies do this?”
She squeezed her own boobs, only to wince. “Awww! Maybe I’m not trying hard enough?” She pushed both her tits into her own mouth, managing to accomplish this with ease, given how heavy her rack was. Getting invested in the act, she continued to swirl her tongue around her nipples, humming happily.
Shrugging, the Megalodon anthro continued to pump her girthy twin dicks between those boobs, huffing as she felt that milk pool around her balls. “More for me, it seems!” She leaned in, ready to burst at any rate. “When you get…back to your world…just tell him how you feel! He’s clearly into you!”
“I don’t knooOOOOOOH! Your cocks! So waaaaaarm!” Maple arched her back, suddenly feeling the shark anthro’s tail grind against her pussy-lips and those cocks throb harder against her breasts.
During this, the Lonely Shark would watch from the corner, the woman masturbating as she continued to watch. She panted heavily, her gills expanding as she took in the arousing sight, especially the one of the much larger and bustier shark-like creature.
But, because she had not taken in most of the aphrodisiac, she could see (out the corner of her eye) that one of the screens in this place was turning on, revealing the p.AI.nter. “H…help me! Please! Sebastian! HEEELLLLLLRRRRRRRRGH…” The poor program exclaimed before a hideous sight showed on the screen.
It looked like a stereotypical big red devil, but there was no mouth. Just horns and a pair of soulless eyes. Emerging from the screen, the fiend that had possessed the poor p.AI.nter had decided to get proactive, ready to claim some more souls for itself.
The very sight of that thing was enough for Velora, mid-cumming, to freeze up. “Ah, shit! I forgot what kind of game we’re in!”
“H-huh?!” Splattered by cum and unable to stop slurping it up, Maple found herself both embarrassed and terrified when she saw the hideous floating demonic entity emerging. “OH, GOODNESS! MY PUNISHMENT FOR EVER THINKING I COULD BE WITH HERALD!”
“Oh, for the love of, it’s just an evil demon out to get our souls! Not that!” Velora face-palmed before grabbing Lindsay, causing her own tits to pop out her lips. “We’re out of here!”
“Q-quiet!” Running as fast as her legs could carry her and hastily putting on her clothes (resulting in a skimpy look that revealed almost all of her nipples in their full glory), she grabbed Lonely Shark as well, hugging her against her cum-stained bust before the four began to flee the soul-hungry demon.
The dreaded and despicable Specimen 11, that’s who!
Notes:
Current Dead:
-Sentinel (Team 5)
-Terry Hintz (Team 4)
-Bernadetta Von Varley, Eduardo, Zenitsu Agatsuma (Team 6)
-Siegfried Muller, Dr. Steel (Team 8)
-Not Spooky (Team 9)
-Susie Lavoie, Michael Myers (Team 11)
-Cobragator, Big the Cat (Team 1)
-The Drifter (Team 3)
-Trixie (Team 7)And now...
-Ivan Ooze (Team 5)
-Springtrap (Team 11)
-Mileena, Juri Han (Team 2)
Chapter Text
Part 6: The Abomination and the Siren
The rush of water that had started because of V1’s antics had resulted in many combatants getting swept away through vast parts of the facility, including yet another training area for those who wanted to utilize an undersea propulsion craft.
Ruby Gillman effortlessly swam through the waters, though it was hard for her to see while Hama and Squid Baron clutched around her massive form. “WHOOOOO!” The Beheaded was enjoying the rush, riding atop pieces of rubble being pushed through the vast network of tunnels.
Launch Octopus fired his missiles at the hero, intent on winning. “See you fools at the finish line! Only somebody as magnificent as me can win!”
“Hey! What about us?!” Squid Baron shouted through the rushing rapids.
“…oh, yes. You’re also here.” The Reploid admitted, though he still propelled himself ahead, ignoring everybody else as they continued through the increasing among of seawater that was pushing the group forth.
A certain shark-shaped being would join the group, chasing them from behind while holding Lindsay close to her chest. “Finally! I’m in my element!” Velora declared, her partner having to hold her breath throughout the whole chase.
Indeed, they were still being hounded by the Food Demon, the demonic entity still looking for souls to devour. Lonely Shark was among the ones on its radar, the smaller shark anthro doing her best to swim while holding onto Maple’s hands.
Though not suited for aquatic stuff, the dragon did her best, holding her breath while using her tail as a rudder. ‘I hope this doesn’t last for long! I don’t know how much more of this I can take!’ She despaired, her cheeks looking purple.
V1 was perfectly suited for this, using his grappling hook to get him through the upcoming maze while still taking fire at Warpath’s group. “Can’t…swim!” The Autobot tank declared, ramming through several rotating fans throughout the tunnels, the rest of his robot buddies also struggling to not be wrecked by the constant movement through the tunnels.
Kleo’s eye was nearly busted, Pathfinder was pinballing across the walls, and Legion had lost his blaster, everything getting harder to visualize due to the increased amount of water and rushing rapids. He held onto Warpath’s leg, the Autobot flailing through the tunnels as every bit of him seemed to bang against something.
It would seem that almost every team had somehow managed to find themselves int his labyrinth of undersea mayhem. Jagi and Adam were getting taken by the rapids, too, the Zardy group having been caught up in the ongoing flood. All they could really do was flail around, the scarecrow slashing his hoe around.
Gabriel was using his holy might to swim through the waters, the entire group holding onto his leg and resulting in a conga-line of swimming. “Daunting though this may be, we may find a way to reach the surface this way!”
“In what way?!” Luigi was also among those that could speak underwater. He had practice, given all the water levels he had gone through, though this scenario was making him miss the Frog Suit.
“I DON’T KNOW! ANY WAY IS BETTER THAN NONE!” He shouted, only for several bolts of magic to nearly strike him. “GAH! Who dares?!”
While Jet Hex was using a spell to create black-flame propellers around his hooves, he was carrying Spike and Moondancer by the hands, the latter having also created air bubbles around their heads while also blasting magic at the group. Granted, each blast would cause water to flood into the air-bubbles, but still.
“You…aren’t…getting away!” She declared.
“Can you let this go!? We need to focus on survival, not slaughter!” Jet Hex pointed out.
“NOBODY IS TAKING THIS WISH FROM ME!” She shouted.
“This is about Twilight, isn’t it?” Spike sighed to himself, understanding where his frantic ally was coming from. The promise of bringing her back from the brink…it was a tempting one, but to throw away one’s morality for that? Was that truly worth it?
(Sewer Creature-Pressure)
https://www.youtube.com/watch?v=NutXAxTAAJk
A hideous roar would indicate to all involved that they weren’t alone. That, and some appropriate chase music. Something was dwelling within these waterways and it would soon not just be hostile combatants and the Food Demon that were things to be feared here.
Barreling through the tunnels was an undead-looking monitor lizard monster, the creature’s gleaming yellow eyes piercing through the murky water as it let out another hideous roar. “WHAT THE FUCK IS THAT?!” Jagi shouted, having nabbed one of those propeller machines alongside Adam.
That guy promptly rammed him until he nearly hit a fan, separating the two, but they’d continue their duel during the chase.
This ‘Abomination’, as it had been described before, was adept at rushing through the tunnels at great speed, pushing past Velora and nearly biting off her arm. “Fuck! Another chase sequence! We’re doing this again!” The only good part was there were opportunities to dodge and it wasn’t an implacable wall.
The Food Demon left, no longer content to chase, but the Abomination was far more savage. Twisted by hate due to the horrible experiments wrought upon it, it would not rest until all in front of it were good as dead.
Lunging again, it attacked Gabriel’s group, the angel firing some blasts to keep it at bay. Nothing worked, forcing the Spirit to slash her sword at the beast. All that did was make it back off a bit, while the group soon found themselves having to avoid a minefield. “INCOMING!” Luigi shouted.
The Pure Vessel used his magic to create several spears out of nowhere, but the Abominations swerved out of the way, but that caused it to head right for Jet Hex’s group.
Spike only had time to scream a little before the monster’s jaws clamped around him, ripping him away from his friend’s grasp and resulting in him getting reduced to giblets by the gnashing jaws. “NO!” Jet Hex shouted. Even the ruthless Moondancer looked horrified at this outcome, but she kept going, never looking back.
A good decision, as the voracious and hateful beast wasn’t done yet. Spitting out the ruined form of the fallen dragon, it rushed again, earning V1’s blasts and even a few pieces of propeller thrown at it by the Beheaded. “Screw off! You’re spoiling the fun!”
“Yeah! The fun that’s just beg-OW!” Warpath hit his head on the ceiling, slowing him down enough for the Abomination to lunge at his head. Metal crunched down with those jaws, his Spark getting extinguished when his barrel struck a landmine.
The explosion pushed many combatants forward, with Hama gripping her tentacles around Ruby’s form even more, but Isaac found his grip on the Hollow Knight’s leg lessening just enough…and that sealed his fate. Letting out a wordless scream of terror, he was sent back into the inferno, the group not noticing until it was too late.
Gabriel was aghast, nearly stopping flapping through the water until the Abomination emerged from the fire, fueled by even further hate. “NOOOO! This cannot be! You were not supposed to-“
“LOOK OUT!” Luigi fired a green fireball at the beast’s eye, disorienting it…and allowing another terror to suddenly surge through the smoke.
Thanks to the Paradox, there was another underwater terror lurking within these depths. Known as ‘The Siren’ for her beguiling mermaid-like appearance, she had lost the element of surprise, causing her to show her skull-like actual face to all she hunted. So voracious that she used to hunt whales in her world, she was determined to devour as many as she could.
The Lonely Shark was the first one it targeted, the shark anthro seeming to know time was almost up when it surged towards her. Using all of her strength, she ensured Maple would be grasping onto Velora’s tail, slowing the down the Megalodon anthro, but she kept that tail going.
Maple looked confused, too busy closing her eyes from all the water around her to notice Lonely Shark giving a sad wave before she was pounced upon by the Siren, devoured in several vicious attacks.
The Abomination paid this no heed, still chasing after the groups through several more minefields. Quickly thinking, the terrified Kogasa fired several blobs of concentrated water from her umbrella, causing a chain reaction of explosions in an effort to defeat the beast again. All that created was a wall of inferno that pushed the teams further through the watery landscape.
Heck, Zardy was nearly annihilated, but he only survived when the Nightshade Paolumu took the brunt of the fire, leaving it critically injured long enough for the Siren to burrow into its form, eating away at it quickly before continuing the chase.
Through another winding tunnel, Ruby used her eye-beams to clear a path, causing much wreckage to start falling into the depths, as well. “You got a real talent for destruction, you know that?!” Squid Baron declared.
In spite of her efforts, the Abomination still got close enough to wrap its jaws around her tentacles, causing her to let out a cry of pain while ink began to flood the waters, created from the wounds. This blinded the behemoth, but the Siren was immune to such things, allowing it to suddenly lunge forward.
“Good luck with the rest of the journey, dear.” Hama gave a comforting kiss to Ruby’s cheek before she dismounted, her suckers finding themselves around the Siren as the horror found itself unable to pursue any further, those suckers clenching hard around its body.
“Hama!” Ruby cried out, only for Squid Baron to fire some missiles behind himself for good measure, causing an explosion that enveloped the two.
“There was no saving her! She made her decision and wanted us to succeed! Let’s at least pay her that final respect!” Sounding unusually serious, Launch Octopus was firm in that, leading the way while Ruby tried to hope that her friend had managed to get out unscathed.
The further the groups went, the more the place seemed to be falling apart at the seams. The recent chase wasn’t helping things, as entire sides of the facility started to explode outwards from the landmines and the other havoc having taken place.
Doors began to appear in the water, all opening and resulting in many combatant groups getting sent to various places in the Paradox facility, the Gabriel’s group heading straight for the end of this course.
Flying from the water, Gabriel slammed against the ground, his remaining allies following suite. The Spirit landed in a heap, Luigi landed on his nose, the Hollow Knight landed horns first, Meta-Knight nearly lost his mask, and the Pure Vessel also fell as a heap.
As they tried to get up, the Abomination landed on the ground as well, only to slip and fall into deeper water, ensuring it wasn’t a threat anymore. “Is the ride over?” Luigi wondered, rubbing his head.
Slamming a fist onto the ground, Gabriel let out a few curses under his breath. “He was but a child…and I failed him…and I swore I saw the machine, as well! Is my life just cursed?!”
“Calm yourself! We are alive and that is all that matters. Do not dwell on every loss.” Meta-Knight advised, his shoulder then poked by the peeved-looking Spirit. “Alright, not all of us are alive per say…let me put it as ‘among the living’.”
For a moment, the Hollow Knight looked as morose as Gabriel was, the Pure Vessel standing alongside him in a moment of camaraderie. Empty as the two may have been, there were still flickers of emotion. Away from the dreaded Radiance and her plague, maybe there was a chance for this to grow?
Aside from the cold water around him, Luigi felt chills for another reason. Familiar with haunted places, he could feel the place seem to…snap, his teeth chattering as he (and soon everybody else) would hear a litany of monstrous sounds echo from across the facility. The Paradox seemed to be going haywire with all that was happening!
What did that mean? Rules were going to be broken. Entities would not stay confined to their usual areas. Not even escaping through doors would help! All the while, whatever was prowling the Paradox would grow more annoyed. More ruthless. More intent on ending this madness.
“Business as usual.” He would speak, hiding in the shadows and surrounded by a sickly green glitchy glow.
‘N…no…set us free…let it go…’
The other voice in his head would be silenced by more glitchy noises, ensuring that the poor soul fused with him would be barely able to voice her objections to whatever he was planning. “I’m sorry, but my contract was very clear. Once I fix the script, stick to it.”
He would vanish again when a massive machine crashed through the side of the blacksite. A ‘Trenchbleeder’ as some called it. The quadrupedal machine was sparking bad, a familiar android flying from it as he avoided the rushing water.
“This should flush you all out, fools.” Perfect Cell smirked, eager to see how far he could push this game until he FINALLY got his victory. Done was he with waiting!
Also, the destruction he got to cause in the process was, to him, quite relaxing. A further showing of his ‘perfection’ to all who dared think they could win this and not him.
Notes:
This was a very short chapter, yes. Mostly because this and the next few chapters are almost non-stop action! In hindsight, this should have been part of the previous chapter. My bad.
Anyway, the end of this Arena is coming soon! Perhaps, in future Arenas, things will be more organized? It's just that, with this one, there's so much of both franchises involved in the setting I wanted to include and the simulation this is based off moved at something of a glacial pace compared to most Arenas. Anyway...
Current Dead:
-Sentinel, Ivan Ooze (Team 5)
-Terry Hintz (Team 4)
-Bernadetta Von Varley, Eduardo, Zenitsu Agatsuma (Team 6)
-Siegfried Muller, Dr. Steel (Team 8)
-Not Spooky (Team 9)
-Susie Lavoie, Michael Myers, Springtrap (Team 11)
-Cobragator, Big the Cat (Team 1)
-The Drifter (Team 3)
-Trixie (Team 7)
-Mileena, Juri Han (Team 2)And now...
-Spike (Team 7)
-Warpath (Team 10)
-Lonely Shark (Team 8)
-Isaac Moriah (Team 4)
-Nightshade Paolumu (Team 9)
-Hama (Team 12)
Chapter 6: An Increasingly Unstable Paradox / The Searchlights and the Demon
Notes:
(See the end of the chapter for notes.)
Chapter Text
Part 7: An Increasingly Unstable Paradox
Absolute madness had taken over the already terrifying location. Doors were starting to fall from their hinges, the inner workings of the Jumpscare Mansion also being revealed as a result.
Velora, Maple, and Lindsay would witness this when they tried to head to another door, the Meat Demon still hot on their trail. “Can’t…keep…going…” Maple panted, all the running getting to her.
“Pull it together!” Velora demanded, the larger being holding her hand while Lindsay stayed between her breasts, finding them much safer than whatever was happening around her. “The sooner we…oh, fuck.”
On the other side of the open door, the rooms seemed to be shifting like one big machine. Entire sections were moving at the speed of light, though some were starting to glitch. There would be only a few moments where they could find an opportunity to slip right through.
Rushing towards the exit, the trio managed to jump into another one of those more medieval-looking rooms, but the floating demon still pursued them, hungry for souls. “Get off our asses, already!” Velora shouted.
“What’s happening behind us and should I be screaming right now?!” Lindsay wondered, the noises she was hearing not exactly being the most comforting to hear.
Maple could almost feel the demon’s claws on her back, the soulless stare metaphorically piercing into her mind without it even having to look at her. It wouldn’t be long before the trio hit another dead-end. One that could be the last one they’d ever see.
Elsewhere, hordes of zombie Expendables were pouring through the various facility rooms, Kleo’s group trying to hold them off. Lasers flew through the air, the ceiling starting to collapse as the possessed beings headed towards the robots. “Make a line! It’s rude to crowd around a lady!” Kleo yelled, the Assaultron running out of juice fast.
“There are too many of them! We suggest a strategic retreat!” Legion stated, running out of ammo. The places where he could find strategic vantage points were running out fast, especially as water started to pool in the areas.
One room had filled up with so much water that it suddenly surged through one of the malfunctioning doors. The rushing waters were one thing, but the fact that Subject 3 was within those waters was another. The centipede/spider monstrosity pounced upon Pathfinder, the legs pinning his limbs down. “Hello! Do you want neck scritches?” He offered in his usually friendly way.
A way that would not be returned, as the mandibles of that fiend crunched down on his head, while the blaster-fire of the other robots rained down on its exoskeleton in the act. Fleeing as fast as it could, it left the duo to deal with the Expendables. “The odds are not looking in our favor.” Legion insisted, throwing an explosion to send waves of the crowd flying.
“Then we party until we can’t party anymore. Don’t be so negative.” Kleo stated, relishing in the realization that, at the very least, she could indulge in her violent urges until the bitter end. If there was one thing she liked about the Arena, it was this.
In another instance of everything going mad, it would have seemed Specimen 5 and 6 had teamed up, the former chasing down the unfortunate combatants through the maze-like area, while the latter kept appearing while their backs were turned to attack. Such was happening in one of the many hallways to several of the combatants.
“That’s it! We’re doomed! You hear me?! DOOMED!” Squid Baron shouted, the background around the cephalopod trio (formerly a quartet) turning distorted and red from the presence of the feminine entity currently wandering after them with her large blade. “We’re officially in Hard Mode now and there’s no going back!”
“Pull it together, fool!” Launch Octopus shouted, firing missiles all over the place just to get at Specimen 6. The puppet-like being snickered as he kept moving up and down the ceiling, while several Wall Dwellers emerged from their hiding places, woken up by the violence as they chased after the duo. “Get away from me, you fiends!”
Ruby did her best not to switch to Kraken mode all the time, as it was proving to be quite taxing. She hid behind Launch Octopus, observing how the rooms were moving on the other side of the door. “NOW!” She declared, having calculated the perfect opportunity to lose the increasing number of fiends.
She and Launch managed to make it through…but Squid Baron found himself pinned by one of the moving rooms. “I FAILED THE QUICK-TIME EVENT!” He cried out, reduced to mulch by the moving room as Specimen 5 continued her chase, merely grabbing one of the shifting walls and pushing it aside to get in.
“Oh, hop on!” In a moment of camaraderie, Launch got Ruby atop his large head, using his tentacles to create air currents so he would propel himself to another one of the shifting room areas, hopefully to put more distance from himself and the others.
At this point, even Zardy was starting to fear for his life, he and Kogasa finding themselves in the forest once more. However, above the trees, the façade of a wide-open area around them was breaking, water rushing around and resulting in a blood-red rain. The deer around them were going haywire, letting out horrific roars as they stampeded.
“YOUR SUBMISSION IS INEVITABLE.” The Deer God ignored the cries of his flock, intent on continuing his desire for more flesh to consume. More souls to make a part of his own form.
“Stand back!” Zardy shouted, throwing his hoe into the being’s body, only for it to be absorbed. “Oh, right. I forgot. He can do that.”
“KEEP RUNNING! This is too many surprises for me to take!” Kogasa declared, hopping away like a rabbit trying to avoid a fox.
Or, in this case, a bunch of carnivorous deer. A stampede of them that suddenly collided with Zardy, bringing the scarecrow down as he struggled to get back up. “Ow! OW! Ow! I’m so glad I don’t have any vital organs!” He muttered.
But his pumpkin-head was still reduced to squash when the hooves really started to increase, the Deer God hovering over the mess as the plant-like components withered in his presence. The entity seemed disappointed that this happened, but he would just continue towards the fleeing yokai, sweat dripping down her brow as she did her best not to look back.
SMASH!
The water above the forest rushed in torrents, a familiar multi-eyed shark opening its maw as it gazed into the eyes of the all the deer, causing them all to look up before they were crushed by the oversized bull shark. The radioactive gaze of the beast was enough to send the Deer God retreating, while Kogasa hopped through one of the many shifting rooms, safe and sound…for now.
Elsewhere, Moondancer was seeming to make it a priority that whatever room she went to would be reduced to a wreck, her magic concentrating the bring the entire place down. “Are you insane?! Don’t answer that! You’ve been crazy since this whole match started!” Jet Hex pointed out, struggling to keep up.
“Whatever keeps the others from trying to get my wish, I’ll do!”
“Who CARES about the wish?! We just need to get the fuck out of here!” He pointed out.
“I CARE! If Twilight’s ever coming back, this is my best chance!” She pointed out. “What happened to her won’t be the end of her destiny! I swear it!”
Several ki blasts smashed into the rock-like walls around them, exposing more of the inner workings of the Jumpscare mansion within the Blacksite. However, it didn’t look like the android that did that was aiming for them.
Perfect Cell was in the middle of trying to get a good shot at V1, the robot using his incredible speed and agility to avoid almost every single blast. “Quite a jumpy one, aren’t you? It won’t save you from what comes next!” Cell declared before creating several copies of himself. “SPECIAL BEAM CANNON!”
Those cannons blasted through the room like a hot knife through butter, but it also resulted in an corpse-like goopy Angler-like beast rushing forth from the shadows, its distorted maw filled with blinking eyes. “Oh, shit!” Jet Hex knew this was the perfect time to run, but Moondancer kept trying to blast at either the android or the robot.
“GIT GUD.” V1 taunted, flicking a coin before firing it and causing the coin to shatter through her horn.
“AAAAAAAAAUGH!” Grasping her head, the unicorn’s magic started to go out of control, bolts of pink magic lighting up the place while Pandemonium pounced on Jet Hex, the distracted unicorn having not seen that abomination coming.
The creature’s goopy mass tried to cover his eyes, as whenever he looked directly at the monster he was trying to push off, it seemed to be getting weaker. “I’m…not…fish food!” He declared, firing a magic blast directly into the eye-filled maw.
Unable to handle such energies, the creature began to melt around him, screeching in horror while Moondancer continued to stumble around, her magic overloading as it struck the various support areas of the room.
Noticing this happening, Cell got a cruel idea. The very look of the Equestrian reminded him of his loss to Queen Celestia, causing him to charge a small Death Ball on his finger. “Nothing like catharsis to lift the mood.” He flung it at the unicorn, just as she was finally regaining control of her broken horn.
The very minute Jet Hex got free from the injured abomination, he was blown forth by the resulting magical/ki explosion, another section of the blacksite crumbling away while the still-alive unicorn fell into one of the holes in the ground, sending him into a mechanism of the Jumpscare mansion, so many rooms passing by him.
He would land safely in the Meat Demon’s old domain, only for several possessed Expendables to be waiting for him there. “Are you kidding me?!” He exclaimed, his fatigue showing as he fired a few weak spells at the undead beings. That gave him plenty of reason to book it.
Deep within a forbidden location known as the ‘Banlands’, Gabriel’s group had found themselves wandering it, surrounded by almost pitch-black darkness…or, at least, that’s how it should have been, but the group had an insta-fix for that.
The Archangel may have been crestfallen over Isaac’s demise, but his determination to see this all to the end (and maybe find that damned machine already) was still there. There was also a voice calling out to him through the darkness. He wasn’t sure what it was, but he knew that-
“LOOK OUT!”
Luigi cried that out before a series of explosive barrels suddenly fell from above, the Pure Vessel instantly moving to slash away at the things. The explosions happened above the group, but that was merely a cover.
Always fighting dirty, Jagi descended from on high, moving through the smoke before applying several finger punches to the lanky entity. “DIE!” He exclaimed when it was over, pulses of light appearing all over the Pure Vessel.
Struggling to make it through those ruptures, it gave its smaller brethren one last meaningful look…before erupting in flashes of light, the substances that had been used to make it having been disrupted so much by Jagi’s technique that his form could not handle it. Even the usually emotionless Knight looked shocked at this turn of events.
Turning to face the group, Jagi laughed, spreading out his arms after throwing away his now-ammo-less shotgun. “I’m this close to the surface! I can SMELL it! I’m not letting some freaks get in my way!” He got into a fighting position, an aggressive yellow aura surrounding him as the others prepared to deal with him.
“I will NOT suffer sinners like you!” Gabriel could almost feel the evil radiating from the masked man. So many atrocities he had committed without shame…he instantly got to creating spears and swords of light, flinging them around the already unstable area.
Luigi used his Poltergust-5000 to send some of them flying at the man, but he dashed past them, almost using the aggression to his advantage. He had been through so many skirmishes that this was old hat to him. Having to deal with the Knight’s needle did perforate his arms a bit, but he ignored those wounds, grabbed the needle, and kneed him in the mask.
Meta-Knight teleported behind him, slashing him across the back before his mask was nearly broken by a kick to the face, several needles spat out towards Gabriel. “ACK! My eyes!” The angel cried out.
“Hahahahaha! I’m gonna tear those stupid wings off and hang them from my wall!” He declared before looking at Luigi. “But, first, I’m gonna tear that nose off! It looks so easy to crush within my hand!”
Protectively hovering a hand above his nose, Luigi backed away slightly. “Stand back, please! Can’t we just get along?”
“So weak…I’m gonna love this!” Dodging past another one of the Knight’s strikes, he leaped into the air, bringing down his fist, only to get uppercutted by Luigi’s fist.
“Should have chosen my option!” The plumber stated, rubbing his wrist as the fighter fell to the ground, Meta-Knight’s blade slashing across his helmet.
Rolling back up, Jagi’s helmet crumbled, revealing his deformed face. “You…YOU’RE DEAD!” Grabbing an oil drum from the crumbling facility, he threw it to the ground, instantly lighting it up as the flames began to spread, pushing everybody back.
That wasn’t enough to stop Gabriel from flying through the flames, spearing him through the chest with a sword of light. “GAH!” He cried out, the holy energy coursing through him before he was thrown down from the air, the Knight lunging upwards with a blast of phantasmal energy concentrated through the needle.
That caused the injuries on his head to reactivate after that fateful battle with Kenshiro, causing his head to start expanding. “NO WAAAAAAAAAAY!” He cried out before he erupted, his essence burning away when his corpse fell upon the burning oil drum.
Regrouping, they all looked upon the flames, watching as they started to spread. “May this snuff out any other shadows that come down on us.” Gabriel stated, while the Knight gave one last look to whatever remained of the Pure Vessel.
There was no turning back. They needed to go forward or perish.
Where was the Spirit during this whole time? Well, turns out, Jagi was a total liar. He had only managed to fight his foe to a stalemate, though Adam still wound up heavily injured from one critical punch to the face that broke his mask, exposing his hideous scars. “When I find that human…I’m going to-“
His luck (well, the luck of making it this far, that is) had run out. A certain ghostly being had appeared from behind, running him through with her sword. His eyes widened, looking to the vengeful spirit. Just by looking into his eyes, the ghostly being could tell what this man had done…what he had done to his loving partner…
To be reminded of one that would twist lost in such a terrible way caused the Spirit to let loose the rage that had been bubbling throughout her whole time in this Arena, causing her to start slicing her blade randomly across his already impaled frame. He barely had enough time to scream before he was essentially turned into salsa.
Moving past that fallen opponent, the Spirit felt something…strange. Much like with the other group, she felt a great sense of calm. It was more pronounced in her, as it almost felt like the loving embrace of her mother. The warmth of the living that she once enjoyed before it was cruelly taken away from her.
That’s when everybody began to converge on a simultaneously beautiful and horrible sight. Deep within the Banlands, there existed a spot that Urbanshade coveted. One that they kept under wraps so tightly that it took this cataclysm to eliminate any security that guarded it.
Something that made the blood within Gabriel’s being run cold. “No…it cannot be…”
“What is it?” Luigi asked, only to see what he was referring to.
In a lone corner of the forbidden location, there was a gigantic white/black being, its arms buried in the ground while two pillars of red light surged around it with power. Tubes were hooked up to this giant, the halo of eyes surrounding the blank white head weakly looking around.
The faint image of wings on the being’s back was there, but they seemed to be fading. Another sign that the being here was weakened by whatever apparatus had been forced upon it. “A most pitiful creature, this is.” Meta-Knight somberly stated. “But what is it?”
“…an angel.” Gabriel stated. “A Guardian Angel…”
While those words sank in, Luigi approached the large being, shivering slightly before realizing something that snuffed out his fear and replaced it with sympathy and horror. “They’re hurt! It’s like this thing is-“
“Draining it dry? Yeah, this is the kind of thing those bastards that made the place don’t want you to see.”
Swimming down to the group was Sebastian, looking roughed up and with almost all this supplies having been drained. “I’m surprised you all made it this far. Then again, since you’re better prepared than the other poor bastards that got sent her, that doesn’t surprise me.”
“Explain NOW.” Gabriel’s tone shook the ground, his body nearly turning crimson with rage. “What has this place DONE to them?!”
“This poor guy?” Sebastian looked to the Guardian Angel, the being’s head hanging low. “This is one of the perks of working for Urbanshade: immortality. Through the angel’s blood, they not only live for longer, but they’re guaranteed to go to Heaven, no matter how unrepentant they are. It says something that my main ‘boss’ was so much of a shit person that the blood stopped working for him.”
“That’s horrible!” Luigi exclaimed. “Is there a way to turn this machine off?!” He frantically looked around, the angel taking notice.
Gazing upon the plumber and noticing how he was actually TRYING to release them, unlike so many others that had come across them, they leaned down, the gaze increasing in intensity as they looked deep within his heart.
Barely any sin. Barely any malice. A kind and gentle soul. The kind of soul that they had not expected to see in so long.
“Let us free you from this perdition!” Gabriel flew in, the larger angel shaking their head. “What do you mean!?”
More silence, but angels still seemed to understand each-other, the other members of the group looking to the fallen archangel for translation. “It’s too late for you? No! There is still time! I will not leave you to rot in this infernal realm!”
“Sorry. No dice. I think they know what’s coming.” Sebastian somberly stated. “This whole place is going down and, only then, will they be free. But not before they know that you’ll be able to stop the ‘ultimate evil’.”
“Ultimate evil?” Meta-Knight asked. “Perhaps the one who created this Paradox?”
“Maybe…him.” Sebastian shuddered. “The guy who keeps showing up to make sure everything ‘sticks to the script’. Urbanshade’s best enforcer. I’ve seen him show up a few times, but something tells me he’s about to do something big if it means keeping this operation going. If you don’t deal with him, nothing you do here will matter. He’ll just reset things.”
The idea of everything going back to the way it was seemed appealing at first thought…but that would mean the evils of this place would remain intact, including the suffering of this angel. In spite of his mounting fear of everything that had happened, Luigi strapped his Poltergust-5000 tighter to himself. “That won’t happen! Just point us in the direction of the boss!”
“It may provide me with an actual challenge.” Meta-Knight stated. “That fight against the masked fiend was not me at my best, admittedly.”
“He shall face retribution at my hands!” Gabriel declared, the Knight raising his needle to join him in that statement. “Quite! This horror has gone on for too long! THIS is proof of that!”
“I couldn’t have said it better myself!” Sebastian chuckled. “I’d say you were all gonna fucking die after you go up against Lopee, buuuuuut something’s off about him. Maybe it’s this paradox, but there’s a good chance you MIGHT actually be able to put him in the fucking ground at long last.”
“Wait. Lopee? That’s his name?” Luigi arched a brow. “Doesn’t sound all that scary.”
“…oh, you have NO idea.”
As for the Beheaded, the man had found himself near the every end of the whole facility, his body floating through the underwater landscape as he swore he saw lights coming up from above. “Finally! Took forever, but-GURK!”
The safety of those lights? A lure. A lie. He only realized that when he felt the harpoon-like limb burrow into his body, dragging him up before his flame-like essence could reform. The Sea Bunny that was on him was knocked off, allowing it to scuttle away to safety.
The whale-sized creatures above were about to potentially enjoy a feast, with the Beheaded serving as a mere appetizer for one. Little did any of them know that their hunting grounds were about to become the scene of a calamity that would shake what little remained of the Blacksite/Mansion combo.
Part 8: The Searchlights and the Demon
Call it fate. Call it luck. Call it whatever you will. Whatever was happening, everything was leading up to pretty much every remaining combatant heading to same location, if only because everything else was crumbling apart so rapidly.
Velora was swimming through the waters quickly to get away from the Food Demon, the villainous being having stopped his chase just to get into the p.AI.nter once more. “H…help!” His voice spoke across the entire underwater landscape, the surface looking so close yet so far.
With Luigi’s group, Sebastian could hear the sound of his buddy in pain, causing him to stop with any explosion to swim in that direction. “Hold on, kid! I’m coming!” He turned to the group. “Better move fast! If you see Lopee, if you maniacs got any super-secret techniques, ideas, or what-have-you, USE THEM NOW!”
The Banlands themselves began to rumble, portals appearing all over the place as the paradoxical nature of the very Mansion itself began to merge with more spots of the Blacksite. “MOVE!” Gabriel shouted, grabbing the Knight while Meta-Knight grabbed Luigi, all flying forward while the Spirit shifted through the walls.
Through some of the rubble, Perfect Cell flew out, not minding the water around him as he crossed his arms. Greenish portals were appearing all around the place, but there were also ghostly beings that looked cartoonish. They were possessing whatever dead things they could find and even a few living creatures, making it seem less like an average haunting and more like a ghostly army.
“Cute.” The android started flying (or just using his wings to flap really fast through the murky depths) through the water before he fired several ki-blasts, destroying more sections of the facility. With any luck, the remaining combatants had not gotten far.
In actuality, many had converged where the whale-like tentacled beasts were floating around, their searchlight-like lights scanning the ground for potential meals. “You think we’re saved?” Lindsay wondered. “Look at all those submarines!”
Upon seeing a random shark get snatched up by harpoon-like tentacles when it passed through the light, Maple gulped. “Those…those don’t look friendly.”
“Shit. More undersea bullshittery.” Velora’s gills huffed. “I’m not even gonna ask how every last one of us is breathing out here.”
Indeed, it seemed odd that those that usually relied on oxygen and not having their lungs filled with water weren’t suffering any adverse effects. That being said, there were signs that NONE of this was natural. The ‘Searchlights’, for instance, seemed to be going faster than usual, driven wild by the paradox breakdown occurring.
The Meat Demon had reappeared through the walls, grabbing around Kleo’s head when he emerged. Legion fired upon him as he assessed the environment around him, but nothing was working against the fiend. “Didn’t anybody tell you how to treat a lady?!” Kleo wondered.
Sensing no soul within the machine, the fiend smashed her against Legion, the Geth struggling to escape from being pinned before they were dragged against the rocks, disabling them for good. “Now’s our chance to run!” Velora shouted, effortlessly swimming through the water as Maple and Lindsay held onto her for dear life.
Alas, Perfect Cell had fired a powerful ki-blast at her side, causing her to roar in pain…and accidentally find herself within the light of the Searchlights. “Oh…SHIT.”
“Oh, dear.” Maple squeaked.
“Oh, crap.” Linday gulped.
SHANK!
Many harpoons went through their forms, creating a macabre shish-kebab that was soon pulled into the voracious maw of the Searchlight before the megalodon anthro had a chance to fight through her grievous injury.
Kogasa hopped through the shadows of this new area, keen to avoid anymore ‘surprises’. She swore she could almost hear the Deer God still patrolling through the portals, causing her fear to mount. ‘I’m supposed to be the one scaring people, but I’m calling it now! I’ve met my match here!’
She wanted this nightmare to stop. This whole game wasn’t fun anymore. In fact, when was it ever fun?! It seemed like one long neverending quest to see which horrific happening could scar the audience more! There were no ‘surprises’! There was only pain and suffering!
Anyway, the Food Demon had hacked into p.AI.nter so much that the entire facility was unleashing its weapons all around the place. Turrets were going crazy. Alarms were driving every creature mad. This fiend would have his souls before anybody else got them and he would have them now!
One Searchlight began to tilt downward, letting out a pained bellow as its attacker continued to attack from all angles. V1 was in need of recharging and the blood of this creature would have to do. The mighty behemoth crashed into the site, right as the Spirit phased through everything. Roaring in fury, she started to phase through more structures, her rage ready to stated once more.
Meta-Knight and Gabriel flew out of the hole, with Sebastian swimming quickly ahead of them. “A terrible demon!” Gabriel pointed at the Food Demon, but his attention was then taken by…take a guess. “Him…THE MACHINE!”
“Gabriel! Focus! We are here to escape! Perhaps even vanquish this ‘Lopee’!” Meta-Knight stated.
“We have even more problems! Look!” Luigi pointed to where Perfect Cell was, the android relishing what seemed to be the final showdown.
Jet Hex had not forgotten what this being had done to his partner. He may have disagreed with much of Moondancer’s actions, but he could tell she was hurting from Twilight’s loss. “Hold still!” To emphasize his frustration, a shockwave of magic fired from his horn, cutting off Cell when he tried to teleport.
The android was stunned, magical energy coursing through his body as he found himself unable to move. “WHAT THE?! Oh, you think you can be a worthy challenger? I’d like to see that!” Tearing himself free of the magic, he raised his hand up, balls of ki raining down as he unleashed them in spurts.
Taking advantage of the dark magic surrounding this whole collapsing paradox, Jet Hex slipped into the shadows around him, teleporting without even teleporting. The blasts of the ki-strikes were eliminating the shadows, reducing his range, but that’s why he was seeking higher ground to maybe get a better shot at the android.
Or maybe there was something else to his plan: keeping him in one place. “I bet you can’t blast me all the way from here!” He taunted.
“Do I detect fighting words?” Cell chuckled, waving a hand and causing a scythe-like energy blast to cleave through the oceanic landscape, causing more of the Blacksite to be destroyed.
What he didn’t know was that one of the Searchlights was coming closer, the light eventually illuminating his patterned chitin the moment Jet ran out of shadows, a piece of rubble pinning him down. “And now, the coupe-de-grace! Any last words?”
“Looks like…I rang the dinner bell.” Jet chuckled, spitting out some blood.
“…I’m sorry, but it’s ME who drinks people for their energy and-GACK!” A harpoon went through his midsection, purple fluid spraying as the android was yanked into one of the maws, the once-powerful being unable to handle the crushing and shredding teeth within.
His regeneration factor would not matter as, in a moment of panic and rage, he unleashed an energy pulse, but that just destroyed him along with the Searchlight. Its corpse began to fall…right towards Jet. “Awwwww…crapbaskets.”
BOOOM!
Luigi covered his head as underwater explosions continued to ring, both from what previously happened and the demise of Cell. “Where’s the exit?! Where is it?!”
“Through battle! We have no choice but to fight until we can’t fight anymore! Just look at what Gabriel is doing!” Meta-Knight helped his friend up, sounding exasperated.
Indeed, Gabriel had not hesitated to clash his blades against V1, who just parried the hit. “I have waited for this day long enough, machine! You may not be the cause of this world’s calamity, but I won’t stand idly by while you inevitably make things worse!”
“SKILL ISSUE!” Grappling to a place behind Gabriel, the machine avoided many slashes of light, which exposed the hiding spot of Launch Octopus and Ruby.
The two cephalopod-like beings were now bearing witness to a hell-born rivalry. A clash between a disgraced angel and a ravenous machine. “Should we help them?” Ruby wondered, in awe as she saw constructs of light descend down, V1 dodging through them before firing even more barrels at the armored being, almost taking off some armor pieces.
“And get myself involved in that mess?! I think not!” The reploid declared. “Victory is almost at hand!”
“Wait, how DO we learn victory? By escape?” Ruby wondered. “We completely lost track of that!’
“It…does seem like the end objective isn’t that properly defined…oh, well! When in doubt, ELIMINATE ALL THAT OFFENDS THE OPTICS!” Randomly, the Reploid fired missiles and oceanic tornados around his side, though he made sure Ruby was outside the radius of such attacks.
Luigi ran for his life from such things, the tornados also causing some of the Searchlights some distress. Their lights kept moving around thanks to the currents, their harpoon-tentacles firing randomly and bringing in mostly inedible food.
Kogasa hopped past such attacks, her umbrella eventually striking the reploid on the head. “OW! How DARE you scuff my chassis!” He pointed his tentacles at the yokai. “Prepare to be exterminated along with that gaudy outfit!”
“Wait! She’s not the enemy! I don’t even know WHO’S the enemy anymore!” Ruby grasped her head, so many different variables confusing her. What was even the point of all this mindless violence anymore?!
Speaking of mindless violence, V1 was bashing all of his multiple fists against Gabriel’s helmet, denting it and causing holy blood to spill onto the ocean ground. “Go to sleep. Go to sleep. Go to sleep.” V1 kept repeating in an almost mocking way.
A needle then pierced through his shoulder, the Knight jumping off to unleash a burst of abyssal magic that cracked the mechanical one’s eye. “Thank you, friend! However, this battle is mine alone! Go and seek freedom from this mayhem! Your destiny is your own…and this is MINE!” Gabriel declared.
Much as the rest of the group wanted to interfere, they were blown back when Gabriel flew through the water and dove back down to create a holy shockwave. The damaged V1 was pushed back, but his wings went into full-power, zooming towards the fallen archangel to punch him directly in the face again, following that up with many more blasts from the ranged weapons.
Weakened by such an assault, Gabriel didn’t notice the Food Demon sneaking behind him, the creature hungering for the soul such as his own. “STAY AWAY!” Luigi activated his Poltergust-5000, sucking the demon closer to him.
The fiend’s eyes widened, having never expected such resistance against him from a mortal. “Do not falter! You have him on the ropes!” Meta-Knight shouted, only to see a massive ghostly army rise from the cracks in the Blacksite around him, many of them having already possessed the remaining corpses of the Expendables. “This doesn’t bode well.”
Slamming the Food Demon against the ground, Luigi had ensured the souls within his form were released, the creature frantically trying to grab them back before being slammed again. Eventually, the machine proved too much for the demon, but, since the vacuum was only designed to suck up ghosts, all that happened was that the being was left vulnerable and on the ground.
Trying to grab for the tired plumber’s soul, the fiend was done in by one of Gabriel’s stray blades stabbing into his chest, causing him to let out a horrific scream before vanishing into mist. “Is it over yet?” Luigi panted, wiping off the sweat from his forehead. “Wait. If I’m underwater, why am I swea-“
BZIIIIIIIIIT!
The entire fight came to a stop, every character freezing up like the whole place had been glitched to Hell. None could move, no matter how hard they tried. It also felt like it was hard to think, the pupils of everybody moving frantically around as they tried to make sense of the situation.
This limbo would be broken when it looked like the darkness around them opened up, the Searchlights pushed back by the new presence. What was forming all around them looked like Spooky herself, given the body and those cute eyes…except something was horribly WRONG.
Her face had contorted into one of pain, her eyes looking at all with a pleading look. “You’re all…so close…I don’t want this…I don’t want-“
“Do be quiet.”
With those words, spoken in a dapper tone, her face shifted into an almost skeletal face made of green glitch, the teeth looking like they’d been twisted into a rictus grin. The glitchy face made it seem like darkness was within the very middle, adding to how distorted it looked.
A pair of skeletal hands grew from the usually stubby limbs of Spooky’s form, more glitchy green electricity emanating from the giant. The ghostly army was circling around this being, as if they saw the abomination as their leader.
“What a fine mess you’ve created.” Mr. Lopee groused. “I will have much to do after I’m done finishing you all off."
Notes:
And so, the only ones left are V1, the Knight, Gabriel, Meta-Knight, Luigi Mario, Kogasa Tatara, Rin "The Spirit" Yamaoka, Ruby Gillman, and Launch Octopus! Who will win this chaotic arena?! Stay tuned!
MaliceBlackfang on Chapter 1 Wed 05 Nov 2025 08:13PM UTC
Comment Actions
The_Wandering_Pikachu on Chapter 1 Mon 10 Nov 2025 11:21AM UTC
Last Edited Mon 10 Nov 2025 11:29AM UTC
Comment Actions
Baskerra_Hellmane on Chapter 1 Mon 10 Nov 2025 08:09PM UTC
Comment Actions
FangOfMoon on Chapter 1 Fri 12 Dec 2025 11:08AM UTC
Comment Actions
Baskerra_Hellmane on Chapter 1 Sat 13 Dec 2025 09:14AM UTC
Last Edited Sat 13 Dec 2025 09:14AM UTC
Comment Actions
FangOfMoon on Chapter 1 Sat 13 Dec 2025 09:15AM UTC
Comment Actions
Maskedgirl18 on Chapter 2 Fri 14 Nov 2025 02:42PM UTC
Comment Actions
Baskerra_Hellmane on Chapter 2 Sat 15 Nov 2025 08:42AM UTC
Comment Actions
The_Wandering_Pikachu on Chapter 2 Tue 25 Nov 2025 12:43PM UTC
Last Edited Tue 25 Nov 2025 12:48PM UTC
Comment Actions
The_Wandering_Pikachu on Chapter 3 Fri 28 Nov 2025 11:38PM UTC
Last Edited Fri 28 Nov 2025 11:59PM UTC
Comment Actions
The_Wandering_Pikachu on Chapter 4 Thu 04 Dec 2025 09:26PM UTC
Last Edited Thu 04 Dec 2025 09:28PM UTC
Comment Actions
The_Wandering_Pikachu on Chapter 5 Mon 08 Dec 2025 11:47AM UTC
Comment Actions
Baskerra_Hellmane on Chapter 5 Sat 13 Dec 2025 09:10AM UTC
Last Edited Sat 13 Dec 2025 09:10AM UTC
Comment Actions